ORK01780

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01780

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01780
Clone name	sj06448
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	COL1A1
cDNA sequence	DNA sequence (4721 bp) Predicted protein sequence (1467 aa)
HaloTag ORF Clone	FHC01780
Flexi ORF Clone	FXC01780
Description	collagen, type I, alpha 1

Features of the cloned cDNA sequence

Description

Length: 4721 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	225 bp
Genome contig ID	gi51511734r_45517637
PolyA signal sequence (None)	+--------+--------+----*----+---- CATGACCAAAAACCAAAAGTGCATTCAACCTTACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGAATAAATAAATAACTTTTTAAAAAAGGAAG

Features of the protein sequence

Description

Length: 1467 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92834	100.0	Collagen alpha ...	Homo sapiens
P02452	100.0	Collagen alpha-...	Homo sapiens
AAB94054	99.9	pro alpha 1(I) ...	Homo sapiens
CAA98968	99.7	prepro-alpha1(I...	Homo sapiens
AAH36531	99.8	Collagen, type ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008161	731	759	PD000007	Collagen helix repeat
	IPR008161	962	993	PD000007	Collagen helix repeat
	IPR000885	1356	1467	PD002078	Fibrillar collagen
HMMPfam	IPR001007	43	98	PF00093	von Willebrand factor
	IPR008160	112	161	PF01391	Collagen triple helix repeat
	IPR008160	180	238	PF01391	Collagen triple helix repeat
	IPR008160	239	298	PF01391	Collagen triple helix repeat
	IPR008160	299	358	PF01391	Collagen triple helix repeat
	IPR008160	359	418	PF01391	Collagen triple helix repeat
	IPR008160	419	478	PF01391	Collagen triple helix repeat
	IPR008160	479	538	PF01391	Collagen triple helix repeat
	IPR008160	539	598	PF01391	Collagen triple helix repeat
	IPR008160	599	658	PF01391	Collagen triple helix repeat
	IPR008160	659	718	PF01391	Collagen triple helix repeat
	IPR008160	719	778	PF01391	Collagen triple helix repeat
	IPR008160	782	841	PF01391	Collagen triple helix repeat
	IPR008160	842	901	PF01391	Collagen triple helix repeat
	IPR008160	902	961	PF01391	Collagen triple helix repeat
	IPR008160	962	1021	PF01391	Collagen triple helix repeat
	IPR008160	1022	1081	PF01391	Collagen triple helix repeat
	IPR008160	1082	1141	PF01391	Collagen triple helix repeat
	IPR008160	1142	1195	PF01391	Collagen triple helix repeat
	IPR000885	1248	1466	PF01410	Fibrillar collagen
HMMSmart	IPR001007	43	98	SM00214	von Willebrand factor
HMMSmart	IPR000885	1231	1467	SM00038	Fibrillar collagen
ProfileScan	IPR001007	41	99	PS50184	von Willebrand factor
ScanRegExp	IPR001007	61	98	PS01208	von Willebrand factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp