Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01780
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01780
Clone name sj06448
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol COL1A1
cDNA sequence DNA sequence (4721 bp)
Predicted protein sequence (1467 aa)
Flexi ORF Clone FXC01780
Description collagen, type I, alpha 1
Features of the cloned cDNA sequence

Length: 4721 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 225 bp
Genome contig ID gi51511734r_45517637
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
CATGACCAAAAACCAAAAGTGCATTCAACCTTACC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGAATAAATAAATAACTTTTTAAAAAAGGAAG

Features of the protein sequence

Length: 1467 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92834 0 100.0 Collagen alpha ...
 Homo sapiens
P02452 0 100.0 Collagen alpha-...
 Homo sapiens
AAB94054 0 99.9 pro alpha 1(I) ...
 Homo sapiens
CAA98968 0 99.7 prepro-alpha1(I...
 Homo sapiens
AAH36531 0 99.8 Collagen, type ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR008161 731 759 PD000007 Collagen helix repeat
IPR008161 962 993 PD000007 Collagen helix repeat
IPR000885 1356 1467 PD002078 Fibrillar collagen
HMMPfam IPR001007 43 98 PF00093 von Willebrand factor
IPR008160 112 161 PF01391 Collagen triple helix repeat
IPR008160 180 238 PF01391 Collagen triple helix repeat
IPR008160 239 298 PF01391 Collagen triple helix repeat
IPR008160 299 358 PF01391 Collagen triple helix repeat
IPR008160 359 418 PF01391 Collagen triple helix repeat
IPR008160 419 478 PF01391 Collagen triple helix repeat
IPR008160 479 538 PF01391 Collagen triple helix repeat
IPR008160 539 598 PF01391 Collagen triple helix repeat
IPR008160 599 658 PF01391 Collagen triple helix repeat
IPR008160 659 718 PF01391 Collagen triple helix repeat
IPR008160 719 778 PF01391 Collagen triple helix repeat
IPR008160 782 841 PF01391 Collagen triple helix repeat
IPR008160 842 901 PF01391 Collagen triple helix repeat
IPR008160 902 961 PF01391 Collagen triple helix repeat
IPR008160 962 1021 PF01391 Collagen triple helix repeat
IPR008160 1022 1081 PF01391 Collagen triple helix repeat
IPR008160 1082 1141 PF01391 Collagen triple helix repeat
IPR008160 1142 1195 PF01391 Collagen triple helix repeat
IPR000885 1248 1466 PF01410 Fibrillar collagen
HMMSmart IPR001007 43 98 SM00214 von Willebrand factor
IPR000885 1231 1467 SM00038 Fibrillar collagen
ProfileScan IPR001007 41 99 PS50184 von Willebrand factor
ScanRegExp IPR001007 61 98 PS01208 von Willebrand factor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp