Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01782
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01782
Clone name sj08759
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LAMB3
cDNA sequence DNA sequence (4249 bp)
Predicted protein sequence (1217 aa)
Flexi ORF Clone FXC01782
Description laminin, beta 3
Features of the cloned cDNA sequence

Length: 4249 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 288 bp
Genome contig ID gi89161185r_207754951
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAAGCTGGGCTGGGCAGTATCCCCCGCCTTTAGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTCCACTGGGGAGGAATCCTGGACCAAGCACAAAAACTTAACAAAAGTGA

Features of the protein sequence

Length: 1217 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q13751 0 100.0 Laminin subunit...
Homo sapiens
EAW93448 0 99.9 laminin, beta 3...
Homo sapiens
AAA61834 0 99.2 laminin S B3 ch...
Homo sapiens
BAA22263 0 99.0 Laminin-5 beta3...
Homo sapiens
XP_001915830 0 85.2 similar to Lami...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002049 437 455 PR00011 EGF-like
IPR002049 538 556 PR00011 EGF-like
IPR002049 562 590 PR00011 EGF-like
IPR002049 591 609 PR00011 EGF-like
HMMPfam IPR008211 71 293 PF00055 Laminin
IPR002049 295 358 PF00053 EGF-like
IPR002049 361 412 PF00053 EGF-like
IPR002049 424 473 PF00053 EGF-like
IPR002049 476 523 PF00053 EGF-like
IPR002049 526 576 PF00053 EGF-like
IPR002049 579 623 PF00053 EGF-like
HMMSmart IPR008211 65 293 SM00136 Laminin
IPR002049 295 358 SM00180 EGF-like
IPR002049 361 421 SM00180 EGF-like
IPR002049 424 473 SM00180 EGF-like
IPR002049 476 523 SM00180 EGF-like
IPR002049 526 576 SM00180 EGF-like
IPR002049 579 623 SM00180 EGF-like
ProfileScan IPR008211 67 294 PS51117 Laminin
IPR002049 295 360 PS50027 EGF-like
IPR002049 361 423 PS50027 EGF-like
IPR002049 424 475 PS50027 EGF-like
IPR002049 476 525 PS50027 EGF-like
IPR002049 526 578 PS50027 EGF-like
IPR002049 579 625 PS50027 EGF-like
ScanRegExp IPR013032 324 335 PS00022 EGF-like region
IPR002049 324 358 PS01248 EGF-like
IPR002049 388 424 PS01248 EGF-like
IPR013032 444 455 PS00022 EGF-like region
IPR002049 444 478 PS01248 EGF-like
IPR013032 496 507 PS00022 EGF-like region
IPR002049 496 528 PS01248 EGF-like
IPR013032 545 556 PS00022 EGF-like region
IPR013032 545 556 PS01186 EGF-like region
IPR013032 598 609 PS00022 EGF-like region
IPR002049 598 629 PS01248 EGF-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp