ORK01787

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01787

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01787
Clone name	pf05178s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EP300
cDNA sequence	DNA sequence (8071 bp) Predicted protein sequence (2428 aa)
HaloTag ORF Clone	FHC01787
Flexi ORF Clone	FXC01787
Description	E1A binding protein p300

Features of the cloned cDNA sequence

Description

Length: 8071 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	577 bp
Genome contig ID	gi89161203f_39718706
PolyA signal sequence (None)	+--------+--------+----*----+---- GGGTGCAAAGATGTTCATTCTTTTAAAAAATGTTT
Flanking genome sequence (186779 - 186828)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAACTGCCTTTCTTCCCCTCAAGTCAACTTTTGTGCTC

Features of the protein sequence

Description

Length: 2428 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q09472	100.0	Histone acetylt...	Homo sapiens
AAA18639	99.7	p300 protein [H...	Homo sapiens
XP_515155	99.7	E1A binding pro...	Pan troglodytes
XP_001102844	99.2	E1A binding pro...	Macaca mulatta
XP_001168572	99.3	E1A binding pro...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	1084	1097	PR00503	Bromodomain
	IPR001487	1100	1116	PR00503	Bromodomain
	IPR001487	1116	1134	PR00503	Bromodomain
	IPR001487	1134	1153	PR00503	Bromodomain
HMMPfam	IPR000197	346	430	PF02135	Zinc finger
	IPR003101	580	660	PF02172	Coactivator CBP
	IPR001487	1068	1158	PF00439	Bromodomain
	IPR010303	1159	1219	PF06001	Protein of unknown function DUF902
	IPR009255	1294	1531	PF06010	Transcriptional coactivation
	IPR000433	1678	1719	PF00569	Zinc finger
	IPR000197	1741	1820	PF02135	Zinc finger
	IPR014744	2004	2120	PF09030	Nuclear receptor coactivator
HMMSmart	IPR000197	346	431	SM00551	Zinc finger
	IPR001487	1062	1172	SM00297	Bromodomain
	IPR000433	1678	1719	SM00291	Zinc finger
	IPR000197	1743	1821	SM00551	Zinc finger
ProfileScan	IPR000197	345	431	PS50134	Zinc finger
	IPR003101	580	659	PS50952	Coactivator CBP
	IPR001487	1081	1153	PS50014	Bromodomain
	IPR000433	1678	1721	PS50135	Zinc finger
	IPR000197	1742	1823	PS50134	Zinc finger
ScanRegExp	IPR001487	1086	1145	PS00633	Bromodomain
ScanRegExp	IPR000433	1684	1709	PS01357	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp