ORK01792

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01792

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01792
Clone name	hh02890
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EFHD1
cDNA sequence	DNA sequence (2192 bp) Predicted protein sequence (352 aa)
HaloTag ORF Clone	FHC01792
Flexi ORF Clone	FXC01792
Description	EF-hand domain-containing protein 1 (Swiprosin-2).

Features of the cloned cDNA sequence

Description

Length: 2192 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1056 bp
Genome contig ID	gi89161199f_233106243
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GCTGTCTTTACAATAAAGAAATCATCTGCCTTTCT
Flanking genome sequence (149488 - 149537)	----+--------+--------+--------+--------+----* ATCTTACAGCTATTTCTTTTTACATTGTACAAATAACGTGGCCATCACAT

Features of the protein sequence

Description

Length: 352 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001143163	1.1e-92	96.5	similar to EF-h...	Pan troglodytes
XP_001109340	5e-72	83.7	similar to EF-h...	Macaca mulatta
BAD92952	2.4e-69	99.6	EF hand domain ...	Homo sapiens
Q9BUP0	6.9e-62	100.0	EF-hand domain-...	Homo sapiens
BAB14634	9.5e-62	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	211	265	PD000012	Calcium-binding EF-hand
HMMPfam	IPR002048	207	235	PF00036	Calcium-binding EF-hand
HMMPfam	IPR002048	243	271	PF00036	Calcium-binding EF-hand
HMMSmart	IPR002048	207	235	SM00054	Calcium-binding EF-hand
HMMSmart	IPR002048	243	271	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002048	203	238	PS50222	Calcium-binding EF-hand
ProfileScan	IPR002048	239	274	PS50222	Calcium-binding EF-hand

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp