Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01793
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01793
Clone name bm05240
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol QARS
cDNA sequence DNA sequence (2428 bp)
Predicted protein sequence (776 aa)
Flexi ORF Clone FXC01793
Description Glutaminyl-tRNA synthetase (EC 6.1.1.18) (Glutamine--tRNA ligase) (GlnRS).
Features of the cloned cDNA sequence

Length: 2428 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 96 bp
Genome contig ID gi89161205r_49008370
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TTCCATGTCAATAAAGAACAGCTAAATTCTCCTAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTCTGTGTGTTATCTCTGCACTTCTAGCATCTGAAGGCCCTGAAGACAT

Features of the protein sequence

Length: 776 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW64954 0 100.0 glutaminyl-tRNA...
Homo sapiens
P47897 0 100.0 Glutaminyl-tRNA...
Homo sapiens
BAF83212 0 99.8 unnamed protein...
Homo sapiens
BAD96230 0 99.7 glutaminyl-tRNA...
Homo sapiens
BAE87806 0 97.8 unnamed protein...
Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000924 268 280 PR00987 Glutamyl/glutaminyl-tRNA synthetase
IPR000924 282 293 PR00987 Glutamyl/glutaminyl-tRNA synthetase
IPR000924 297 310 PR00987 Glutamyl/glutaminyl-tRNA synthetase
IPR000924 437 447 PR00987 Glutamyl/glutaminyl-tRNA synthetase
HMMPfam IPR007639 2 164 PF04558 Glutaminyl-tRNA synthetase
IPR007638 165 257 PF04557 Glutaminyl-tRNA synthetase
IPR000924 264 564 PF00749 Glutamyl/glutaminyl-tRNA synthetase
IPR000924 566 753 PF03950 Glutamyl/glutaminyl-tRNA synthetase
HMMTigr IPR004514 265 775 TIGR00440 Glutaminyl-tRNA synthetase
ScanRegExp IPR001412 271 282 PS00178 Aminoacyl-tRNA synthetase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp