Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01794
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01794
Clone name ef06171
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PLK2
cDNA sequence DNA sequence (2757 bp)
Predicted protein sequence (719 aa)
Flexi ORF Clone FXC01794
Description Serine/threonine-protein kinase PLK2 (EC 2.7.11.21) (Polo-like kinase 1) (PLK-2) (Serine/threonine-protein kinase SNK) (Serum-inducible kinase).
Features of the cloned cDNA sequence

Length: 2757 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 596 bp
Genome contig ID gi51511721r_57685571
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
TTTTAAACCGTTGGCAATAAAGAGTATGAAAACGC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGAAATAATGGTCTCCTGTCTTTAGTAGAACTCTTCACCACATCGTTACA

Features of the protein sequence

Length: 719 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NYY3 0 100.0 Serine/threonin...
 Homo sapiens
AAQ02423 0 100.0 serum-inducible...
 synthetic construct
XP_001140767 0 99.8 polo-like kinas...
 Pan troglodytes
AAC14573 0 99.8 serum-inducible...
 Homo sapiens
Q5R4L1 0 99.7 Serine/threonin...
 Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 116 368 PD000001 Protein kinase
HMMPfam IPR000719 116 368 PF00069 Protein kinase
IPR000959 544 607 PF00659 POLO box duplicated region
IPR000959 640 711 PF00659 POLO box duplicated region
HMMSmart IPR001245 116 368 SM00219 Tyrosine protein kinase
IPR002290 116 368 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 116 368 PS50011 Protein kinase
IPR000959 544 607 PS50078 POLO box duplicated region
IPR000959 640 711 PS50078 POLO box duplicated region
ScanRegExp IPR000719 122 154 PS00107 Protein kinase
IPR008271 235 247 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp