ORK01804

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01804

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01804
Clone name	bm02726
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PRKAR1B
cDNA sequence	DNA sequence (2418 bp) Predicted protein sequence (394 aa)
HaloTag ORF Clone	FHC01804
Flexi ORF Clone	FXC01804
Description	cAMP-dependent protein kinase type I-beta regulatory subunit.

Features of the cloned cDNA sequence

Description

Length: 2418 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1232 bp
Genome contig ID	gi89161213r_455361
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- AATACTGCATGAAGCATTAAACGTGCAATGAAGTA
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCTCTTCCCGGCTCGGGAGGCCTTGGTCTGAAGTCTTTTGTAGATAAGGG

Features of the protein sequence

Description

Length: 394 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH36828	1.2e-155	100.0	Protein kinase,...	Homo sapiens
BAF82153	2.9e-155	99.7	unnamed protein...	Homo sapiens
P31321	3.4e-155	99.7	cAMP-dependent ...	Homo sapiens
AAC37564	9.7e-155	99.7	cAMP-dependent ...	Homo sapiens
EAW87164	5.4e-152	98.1	protein kinase,...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002373	171	185	PR00103	cAMP/cGMP-dependent protein kinase
	IPR002373	186	200	PR00103	cAMP/cGMP-dependent protein kinase
	IPR002373	335	344	PR00103	cAMP/cGMP-dependent protein kinase
	IPR002373	347	358	PR00103	cAMP/cGMP-dependent protein kinase
	IPR002373	368	380	PR00103	cAMP/cGMP-dependent protein kinase
HMMPfam	IPR003117	38	75	PF02197	cAMP-dependent protein kinase regulator
	IPR000595	168	253	PF00027	Cyclic nucleotide-binding
	IPR000595	286	377	PF00027	Cyclic nucleotide-binding
HMMSmart	IPR003117	38	75	SM00394	cAMP-dependent protein kinase regulator
	IPR000595	150	266	SM00100	Cyclic nucleotide-binding
	IPR000595	268	387	SM00100	Cyclic nucleotide-binding
ProfileScan	IPR000595	150	265	PS50042	Cyclic nucleotide-binding
ProfileScan	IPR000595	268	389	PS50042	Cyclic nucleotide-binding
ScanRegExp	IPR000595	177	193	PS00888	Cyclic nucleotide-binding
	IPR000595	213	230	PS00889	Cyclic nucleotide-binding
	IPR000595	295	311	PS00888	Cyclic nucleotide-binding
	IPR000595	337	354	PS00889	Cyclic nucleotide-binding

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp