Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01805
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01805
Clone name bm02855
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol STRAP
cDNA sequence DNA sequence (1755 bp)
Predicted protein sequence (402 aa)
Flexi ORF Clone FXC01805
Description Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats).
Features of the cloned cDNA sequence

Length: 1755 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 497 bp
Genome contig ID gi89161190f_15826704
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
TGTTTTTAGTTGTCTAAATAAAATGCCTCTAAAAC
Flanking genome sequence
(120973 - 121022)		 
----+----*----+----*----+----*----+----*----+----*
AAAACAATGTTTGGTTTTTTTGGGGAAAAACTACTAATGTGAGTTTTATA

Features of the protein sequence

Length: 402 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001497523 3e-142 91.1 similar to seri...
 Equus caballus
Q9Y3F4 2.4e-141 100.0 Serine-threonin...
 Homo sapiens
AAX36803 2.4e-141 100.0 serine/threonin...
 synthetic construct
AAX32050 4.9e-141 99.7 serine/threonin...
 synthetic construct
CAB66626 5.7e-141 99.7 hypothetical pr...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001680 313 346 PD000018 WD40 repeat
FPrintScan IPR001680 126 140 PR00320 WD40 repeat
IPR001680 167 181 PR00320 WD40 repeat
IPR001680 332 346 PR00320 WD40 repeat
HMMPfam IPR001680 56 92 PF00400 WD40 repeat
IPR001680 101 139 PF00400 WD40 repeat
IPR001680 143 180 PF00400 WD40 repeat
IPR001680 185 222 PF00400 WD40 repeat
IPR001680 266 303 PF00400 WD40 repeat
IPR001680 307 345 PF00400 WD40 repeat
HMMSmart IPR001680 55 97 SM00320 WD40 repeat
IPR001680 100 139 SM00320 WD40 repeat
IPR001680 142 180 SM00320 WD40 repeat
IPR001680 184 222 SM00320 WD40 repeat
IPR001680 225 262 SM00320 WD40 repeat
IPR001680 265 303 SM00320 WD40 repeat
IPR001680 306 345 SM00320 WD40 repeat
ProfileScan IPR001680 62 354 PS50294 WD40 repeat
IPR001680 107 148 PS50082 WD40 repeat
IPR001680 148 189 PS50082 WD40 repeat
IPR001680 191 231 PS50082 WD40 repeat
IPR001680 313 345 PS50082 WD40 repeat
ScanRegExp IPR001680 126 140 PS00678 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp