Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01814
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01814
Clone name bm04965
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CLK1
cDNA sequence DNA sequence (1766 bp)
Predicted protein sequence (513 aa)
Flexi ORF Clone FXC01814
Description cell division cycle 2-like 1 (PITSLRE proteins)
Features of the cloned cDNA sequence

Length: 1766 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 223 bp
Genome contig ID gi89161199r_201326051
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AGTGATTTATTCAGAATAAATTTTTTGTGCTTATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTTGATATGTATCTGAACAGTTTGTTCTAAGTACCATTTTTCTTCCTA

Features of the protein sequence

Length: 513 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG57578 3.4e-192 99.3 unnamed protein...
Homo sapiens
P49759 5.6e-192 100.0 Dual specificit...
Homo sapiens
AAX41027 5.6e-192 100.0 CDC-like kinase...
synthetic construct
XP_001170873 1.3e-191 99.7 CDC-like kinase...
Pan troglodytes
AAA61480 1.9e-191 99.7 clk1; putative ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 190 398 PD000001 Protein kinase
HMMPfam IPR000719 190 506 PF00069 Protein kinase
HMMSmart IPR001245 190 506 SM00219 Tyrosine protein kinase
IPR002290 190 506 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 190 506 PS50011 Protein kinase
ScanRegExp IPR000719 196 220 PS00107 Protein kinase
IPR008271 313 325 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp