Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01815
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01815
Clone name bm05352
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol HSP90AB1
cDNA sequence DNA sequence (2543 bp)
Predicted protein sequence (752 aa)
Flexi ORF Clone FXC01815
Description Heat shock protein HSP 90-beta (HSP 84) (HSP 90).
Features of the cloned cDNA sequence

Length: 2543 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 284 bp
Genome contig ID gi89161210f_44222827
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AAGTATGCAAAATAAAGAATATGCCGTTTTTATAC
Flanking genome sequence
(106772 - 106821)
----+----*----+----*----+----*----+----*----+----*
AGTTCTGCTTTCCCTTGTGAAGTGGATGTTATCCTTCCCTAGCTTCTTCA

Features of the protein sequence

Length: 752 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P08238 0 100.0 Heat shock prot...
Homo sapiens
XP_001137889 0 99.7 similar to heat...
Pan troglodytes
Q9GKX8 0 99.8 Heat shock prot...
Equus caballus
Q5R710 0 99.7 Heat shock prot...
Pongo abelii
Q76LV1 0 99.5 Heat shock prot...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001404 41 61 PR00775 Heat shock protein Hsp90
IPR001404 62 84 PR00775 Heat shock protein Hsp90
IPR001404 111 128 PR00775 Heat shock protein Hsp90
IPR001404 129 146 PR00775 Heat shock protein Hsp90
IPR001404 154 176 PR00775 Heat shock protein Hsp90
IPR001404 205 222 PR00775 Heat shock protein Hsp90
IPR001404 223 241 PR00775 Heat shock protein Hsp90
HMMPfam IPR003594 63 216 PF02518 ATP-binding region
IPR001404 219 752 PF00183 Heat shock protein Hsp90
HMMSmart IPR003594 63 217 SM00387 ATP-binding region
ScanRegExp IPR001404 61 70 PS00298 Heat shock protein Hsp90
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp