Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01826
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209887
Product ID ORK01826
Clone name eg00444
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol WDR26
cDNA sequence DNA sequence (6623 bp)
Predicted protein sequence (725 aa)
Flexi ORF Clone FXC01826
Description WD repeat protein 26 (CUL4- and DDB1-associated WDR protein 2) (Myocardial ischemic preconditioning up-regulated protein 2).
Features of the cloned cDNA sequence

Length: 6623 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4443 bp
Genome contig ID gi89161185r_222539717
PolyA signal sequence
(ATTAAA,-19)		 
+----*----+----*----+----*----+----
TTTCTTTGCTTTATTCATTAAAGTATAAAAACTTC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGGTCTCTGATATTTATTTTCACTTGTTTACTAATTATTTACAAAACACC

Features of the protein sequence

Length: 725 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93124 2.6e-215 100.0 WD repeat domai...
 Homo sapiens
Q9H7D7 4.6e-197 100.0 WD repeat-conta...
 Homo sapiens
EAW69720 1.6e-196 99.8 WD repeat domai...
 Homo sapiens
Q8C6G8 3.3e-170 95.1 WD repeat-conta...
 Mus musculus
XP_419389 6.1e-162 87.3 similar to WD r...
 Gallus gallus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001680 415 448 PD000018 WD40 repeat
IPR001680 673 705 PD000018 WD40 repeat
FPrintScan IPR001680 434 448 PR00320 WD40 repeat
IPR001680 650 664 PR00320 WD40 repeat
IPR001680 693 707 PR00320 WD40 repeat
HMMPfam IPR001680 409 447 PF00400 WD40 repeat
IPR001680 455 493 PF00400 WD40 repeat
IPR001680 500 529 PF00400 WD40 repeat
IPR001680 626 663 PF00400 WD40 repeat
IPR001680 667 706 PF00400 WD40 repeat
HMMSmart IPR006595 220 295 SM00668 CTLH
IPR001680 408 447 SM00320 WD40 repeat
IPR001680 454 495 SM00320 WD40 repeat
IPR001680 498 538 SM00320 WD40 repeat
IPR001680 621 663 SM00320 WD40 repeat
IPR001680 666 706 SM00320 WD40 repeat
ProfileScan IPR006594 187 219 PS50896 LisH dimerisation motif
IPR006595 220 295 PS50897 CTLH
IPR001680 415 456 PS50082 WD40 repeat
IPR001680 415 705 PS50294 WD40 repeat
IPR001680 461 492 PS50082 WD40 repeat
IPR001680 673 705 PS50082 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp