Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01829
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209912
Product ID ORK01829
Clone name ej00565
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol THBS1
cDNA sequence DNA sequence (3904 bp)
Predicted protein sequence (1225 aa)
Flexi ORF Clone FXC01829
Description Thrombospondin-1 precursor.
Features of the cloned cDNA sequence

Length: 3904 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 226 bp
Genome contig ID gi51511731f_37560586
PolyA signal sequence
(AATGAA,-25)
+----*----+----*----+----*----+----
TTCAGCCTCCAATGAATAAGACATCTTCCAAGCAT
Flanking genome sequence
(114504 - 114553)
----+----*----+----*----+----*----+----*----+----*
ATAAACAATTGCTTTGGTTTCCTTTTGAAAAAGCATCTACTTGCTTCAGT

Features of the protein sequence

Length: 1225 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93149 0 100.0 thrombospondin ...
Homo sapiens
XP_510294 0 99.5 thrombospondin ...
Pan troglodytes
XP_001093770 0 98.6 similar to thro...
Macaca mulatta
BAG10999 0 100.0 thrombospondin-...
synthetic construct
P07996 0 99.9 Thrombospondin-...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR008085 491 504 PR01705 Thrombospondin
IPR008085 509 520 PR01705 Thrombospondin
IPR008085 528 539 PR01705 Thrombospondin
HMMPfam IPR001007 373 427 PF00093 von Willebrand factor
IPR000884 438 483 PF00090 Thrombospondin
IPR000884 494 544 PF00090 Thrombospondin
IPR000884 551 601 PF00090 Thrombospondin
IPR006209 705 744 PF00008 EGF-like
IPR003367 782 794 PF02412 Thrombospondin type 3 repeat
IPR003367 818 830 PF02412 Thrombospondin type 3 repeat
IPR003367 841 853 PF02412 Thrombospondin type 3 repeat
IPR003367 854 869 PF02412 Thrombospondin type 3 repeat
IPR003367 877 889 PF02412 Thrombospondin type 3 repeat
IPR003367 900 912 PF02412 Thrombospondin type 3 repeat
IPR003367 915 930 PF02412 Thrombospondin type 3 repeat
IPR003367 938 950 PF02412 Thrombospondin type 3 repeat
IPR003367 951 966 PF02412 Thrombospondin type 3 repeat
IPR003367 974 986 PF02412 Thrombospondin type 3 repeat
IPR003367 987 1002 PF02412 Thrombospondin type 3 repeat
IPR008859 1027 1225 PF05735 Thrombospondin
HMMSmart IPR003129 79 276 SM00210 Laminin G
IPR001007 373 427 SM00214 von Willebrand factor
IPR000884 437 484 SM00209 Thrombospondin
IPR000884 493 545 SM00209 Thrombospondin
IPR000884 550 602 SM00209 Thrombospondin
IPR001881 597 642 SM00179 EGF-like calcium-binding
IPR006210 605 642 SM00181 EGF
IPR001881 643 700 SM00179 EGF-like calcium-binding
IPR006210 646 700 SM00181 EGF
IPR006210 704 745 SM00181 EGF
ProfileScan IPR001007 371 428 PS50184 von Willebrand factor
IPR000884 434 484 PS50092 Thrombospondin
IPR000884 490 545 PS50092 Thrombospondin
IPR000884 547 602 PS50092 Thrombospondin
IPR000742 602 642 PS50026 EGF-like
IPR000742 701 745 PS50026 EGF-like
ScanRegExp IPR001007 391 427 PS01208 von Willebrand factor
IPR013032 731 744 PS01186 EGF-like region

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 55 TMGLAWGLGVLFLMHVCGTNRIP 77 PRIMARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp