Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01832
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01832
Clone name ek00374
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TRIM3
cDNA sequence DNA sequence (2820 bp)
Predicted protein sequence (778 aa)
Flexi ORF Clone FXC01832
Description tripartite motif-containing 3
Features of the cloned cDNA sequence

Length: 2820 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 414 bp
Genome contig ID gi51511727r_6326420
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
CCCACCCCCCATATTAAATAAATGTCTTCACCAAG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATGTTTTTGCTGGGTTCTTGTGGGGTGGGGCTGCAGTGAGGAGATGGGAT

Features of the protein sequence

Length: 778 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75382 0 100.0 Tripartite moti...
 Homo sapiens
AAG53474 0 99.1 tripartite moti...
 Homo sapiens
AAI51316 0 99.1 TRIM3 protein [...
 Bos taurus
XP_001109454 0 99.3 similar to trip...
 Macaca mulatta
XP_534038 0 99.0 similar to trip...
 Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000315 158 175 PR01406 Zinc finger
IPR000315 176 190 PR01406 Zinc finger
HMMPfam IPR001841 56 96 PF00097 Zinc finger
IPR000315 144 185 PF00643 Zinc finger
IPR001298 355 449 PF00630 Filamin/ABP280 repeat
IPR001258 520 547 PF01436 NHL repeat
IPR001258 567 594 PF01436 NHL repeat
IPR001258 609 636 PF01436 NHL repeat
IPR001258 656 683 PF01436 NHL repeat
IPR001258 703 730 PF01436 NHL repeat
IPR001258 747 774 PF01436 NHL repeat
HMMSmart IPR001841 56 96 SM00184 Zinc finger
IPR000315 144 185 SM00336 Zinc finger
IPR003649 192 318 SM00502 B-box
IPR001298 355 455 SM00557 Filamin/ABP280 repeat
ProfileScan IPR001841 56 97 PS50089 Zinc finger
IPR000315 144 185 PS50119 Zinc finger
IPR001298 351 452 PS50194 Filamin/ABP280 repeat
IPR013017 507 550 PS51125 NHL repeat
IPR013017 554 597 PS51125 NHL repeat
IPR013017 598 639 PS51125 NHL repeat
IPR013017 643 686 PS51125 NHL repeat
IPR013017 690 733 PS51125 NHL repeat
IPR013017 734 777 PS51125 NHL repeat
ScanRegExp IPR001841 71 80 PS00518 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp