ORK01833

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01833

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01833
Clone name	fj10280
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TTC17
cDNA sequence	DNA sequence (4618 bp) Predicted protein sequence (1197 aa)
HaloTag ORF Clone	FHC01833
Flexi ORF Clone	FXC01833
Description	Tetratricopeptide repeat protein 17 (TPR repeat protein 17).

Features of the cloned cDNA sequence

Description

Length: 4618 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1023 bp
Genome contig ID	gi51511727f_43237083
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ACATACTGAGAAAAAAAATAAAATTGTTTATGAGC
Flanking genome sequence (235972 - 236021)	----+--------+--------+--------+--------+----* AAAATAGGTCTGTCATGTGATTTTTCTTTAGAACCTGACTAATTTGGGCA

Features of the protein sequence

Description

Length: 1197 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001157558	99.6	tetratricopepti...	Pan troglodytes
XP_001114312	97.7	similar to tetr...	Macaca mulatta
XP_533149	97.4	similar to tetr...	Canis lupus fam...
NP_898929	94.7	tetratricopepti...	Mus musculus
BAG11018	100.0	tetratricopepti...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	294	327	PF00515	Tetratricopeptide TPR_1
	IPR001440	618	651	PF00515	Tetratricopeptide TPR_1
	IPR013105	688	721	PF07719	Tetratricopeptide TPR_2
	IPR001440	1141	1174	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	294	327	SM00028	Tetratricopeptide region
	IPR013026	618	651	SM00028	Tetratricopeptide region
	IPR013026	654	687	SM00028	Tetratricopeptide region
	IPR013026	688	721	SM00028	Tetratricopeptide region
	IPR013026	1071	1104	SM00028	Tetratricopeptide region
	IPR013026	1107	1140	SM00028	Tetratricopeptide region
	IPR013026	1141	1174	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	294	327	PS50005	Tetratricopeptide region
	IPR013026	294	327	PS50293	Tetratricopeptide region
	IPR013026	618	651	PS50005	Tetratricopeptide region
	IPR013026	618	721	PS50293	Tetratricopeptide region
	IPR013026	688	721	PS50005	Tetratricopeptide region
	IPR013026	1070	1174	PS50293	Tetratricopeptide region
	IPR013026	1141	1174	PS50005	Tetratricopeptide region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp