ORK01834

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01834

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01834
Clone name	hk02144
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RASA3
cDNA sequence	DNA sequence (4150 bp) Predicted protein sequence (862 aa)
HaloTag ORF Clone	FHC01834
Flexi ORF Clone	FXC01834
Description	Ras GTPase-activating protein 3 (GAP1(IP4BP)) (Ins P4-binding protein).

Features of the cloned cDNA sequence

Description

Length: 4150 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1560 bp
Genome contig ID	gi51511729r_113665300
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TTTACTGGCCAATTAAAACAGATGTTTTATTCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTGAGGACTGCCTTGGTTTTCCAGTGGTACCCACTGGGAATTGCACATGT

Features of the protein sequence

Description

Length: 862 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_509751	99.7	RAS p21 protein...	Pan troglodytes
AAH38456	100.0	RAS p21 protein...	Homo sapiens
Q14644	99.7	Ras GTPase-acti...	Homo sapiens
BAB55802	94.8	R-ras RTPase ac...	Mus musculus
BAE28213	94.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	188	200	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	216	229	PR00360	C2 calcium-dependent membrane targeting
	IPR001562	696	715	PR00402	Tec/Btk
	IPR001562	727	740	PR00402	Tec/Btk
HMMPfam	IPR000008	42	124	PF00168	C2 calcium-dependent membrane targeting
	IPR000008	175	275	PF00168	C2 calcium-dependent membrane targeting
	IPR001936	379	552	PF00616	Ras GTPase-activating protein
	IPR001849	605	705	PF00169	Pleckstrin-like
	IPR001562	707	743	PF00779	Tec/Btk
HMMSmart	IPR000008	41	139	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	174	290	SM00239	C2 calcium-dependent membrane targeting
	IPR001936	303	642	SM00323	Ras GTPase-activating protein
	IPR001849	605	707	SM00233	Pleckstrin-like
	IPR001562	707	743	SM00107	Tec/Btk
ProfileScan	IPR000008	38	124	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	169	275	PS50004	C2 calcium-dependent membrane targeting
	IPR001936	358	552	PS50018	Ras GTPase-activating protein
	IPR001849	604	705	PS50003	Pleckstrin-like
	IPR001562	707	743	PS51113	Tec/Btk
ScanRegExp	IPR001936	508	522	PS00509	Ras GTPase-activating protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp