ORK01839

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01839

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01839
Clone name	ha02782
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	KIT
cDNA sequence	DNA sequence (5118 bp) Predicted protein sequence (986 aa)
HaloTag ORF Clone	FHC01839
Flexi ORF Clone	FXC01839
Description	Mast/stem cell growth factor receptor precursor (EC 2.7.10.1) (SCFR) (Proto-oncogene tyrosine-protein kinase Kit) (c-kit) (CD117 antigen).

Features of the cloned cDNA sequence

Description

Length: 5118 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2156 bp
Genome contig ID	gi89161207f_55118896
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTGAAGAATTCTAATAAAATGTACATATATAAATC
Flanking genome sequence (182742 - 182791)	----+--------+--------+--------+--------+----* AAGTGGAGTCATTTGATTGTTGAGATTCGTTGAGATTAAACTTTAAAGCA

Features of the protein sequence

Description

Length: 986 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_517285	99.6	v-kit Hardy-Zuc...	Pan troglodytes
AAC50969	100.0	KIT protein [Ho...	Homo sapiens
P10721	99.5	Mast/stem cell ...	Homo sapiens
AAH71593	99.3	KIT protein [Ho...	Homo sapiens
XP_001089071	97.9	v-kit Hardy-Zuc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	602	696	PD000001	Protein kinase
BlastProDom	IPR000719	781	929	PD000001	Protein kinase
HMMPfam	IPR013151	240	306	PF00047	Immunoglobulin
HMMPfam	IPR001245	599	934	PF07714	Tyrosine protein kinase
HMMSmart	IPR003599	57	126	SM00409	Immunoglobulin subtype
	IPR003599	232	322	SM00409	Immunoglobulin subtype
	IPR003598	238	311	SM00408	Immunoglobulin subtype 2
	IPR003599	334	424	SM00409	Immunoglobulin subtype
	IPR001245	599	934	SM00219	Tyrosine protein kinase
	IPR002290	599	938	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	226	322	PS50835	Immunoglobulin-like
ProfileScan	IPR000719	599	947	PS50011	Protein kinase
ScanRegExp	IPR000719	605	633	PS00107	Protein kinase
	IPR001824	658	671	PS00240	Receptor tyrosine kinase
	IPR008266	798	810	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	12	ATAMRGARGAWDFLCVLLLLLRV	34	SECONDARY	23
SOSUI2	2	532	FTPLLIGFVIVAGMMCIIVMILT	554	PRIMARY	23