ORK01840

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01840

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01840
Clone name	hj05106
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SEMA3C
cDNA sequence	DNA sequence (4854 bp) Predicted protein sequence (777 aa)
HaloTag ORF Clone	FHC01840
Flexi ORF Clone	FXC01840
Description	Semaphorin-3C precursor (Semaphorin E) (Sema E).

Features of the cloned cDNA sequence

Description

Length: 4854 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2360 bp
Genome contig ID	gi89161213r_80109791
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATTGGCCTGGCAAAATAAAACATGTTGAATTCCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTATGTTTCTAGCTTTTATTTTTAATGTAGGGTTAACTTACTTGTTAG

Features of the protein sequence

Description

Length: 777 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG65151	99.6	unnamed protein...	Homo sapiens
Q99985	100.0	Semaphorin-3C; ...	Homo sapiens
XP_527801	99.8	semaphorin 3C i...	Pan troglodytes
CAH89932	99.6	hypothetical pr...	Pongo abelii
XP_001108385	99.3	similar to sema...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	80	521	PF01403	Semaphorin/CD100 antigen
HMMSmart	IPR001627	80	521	SM00630	Semaphorin/CD100 antigen
	IPR003659	539	591	SM00423	Plexin/semaphorin/integrin
	IPR003599	603	688	SM00409	Immunoglobulin subtype
ProfileScan	IPR001627	54	537	PS51004	Semaphorin/CD100 antigen
ProfileScan	IPR007110	616	681	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	4	DFSVLISFNLGIFPWILTCISEE	26	SECONDARY	23
SOSUI2	2	29	FRTICVLVGVFICSICVKGSSQ	50	PRIMARY	22