Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01844
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01844
Clone name eh00656
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol NID2
cDNA sequence DNA sequence (4909 bp)
Predicted protein sequence (1381 aa)
Flexi ORF Clone FXC01844
Description Nidogen-2 precursor (NID-2) (Osteonidogen).
Features of the cloned cDNA sequence

Length: 4909 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 677 bp
Genome contig ID gi51511730r_51441277
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
TTTCTAGATTACTCCAATAAAGTGTTTTAAGTTTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
CCTATGACTTAAGGATCTATATTGTCTCTAGGACAAAGCTGGGGGTTGGC

Features of the protein sequence

Length: 1381 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11043 0 100.0 nidogen-2 precu...
 synthetic construct
Q14112 0 99.9 Nidogen-2; Shor...
 Homo sapiens
EAW65658 0 99.7 nidogen 2 (oste...
 Homo sapiens
NP_031387 0 99.6 nidogen-2 precu...
 Homo sapiens
BAF84341 0 99.6 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003886 185 279 PF06119 Nidogen
IPR006605 532 723 PF07474 G2 nidogen and fibulin G2F
IPR006209 769 805 PF00008 EGF-like
IPR013091 807 848 PF07645 EGF calcium-binding
IPR013091 898 935 PF07645 EGF calcium-binding
IPR000716 946 1011 PF00086 Thyroglobulin type-1
IPR000716 1025 1090 PF00086 Thyroglobulin type-1
IPR000033 1160 1202 PF00058 Low-density lipoprotein receptor
IPR000033 1204 1245 PF00058 Low-density lipoprotein receptor
IPR000033 1247 1290 PF00058 Low-density lipoprotein receptor
IPR000033 1292 1332 PF00058 Low-density lipoprotein receptor
HMMSmart IPR003886 114 281 SM00539 Nidogen
IPR006210 493 530 SM00181 EGF
IPR006605 531 763 SM00682 G2 nidogen and fibulin G2F
IPR001881 765 806 SM00179 EGF-like calcium-binding
IPR006210 768 806 SM00181 EGF
IPR001881 807 849 SM00179 EGF-like calcium-binding
IPR006210 810 849 SM00181 EGF
IPR001881 856 897 SM00179 EGF-like calcium-binding
IPR006210 857 897 SM00181 EGF
IPR001881 898 936 SM00179 EGF-like calcium-binding
IPR006210 901 936 SM00181 EGF
IPR000716 966 1015 SM00211 Thyroglobulin type-1
IPR000716 1046 1094 SM00211 Thyroglobulin type-1
IPR000033 1140 1182 SM00135 Low-density lipoprotein receptor
IPR000033 1184 1226 SM00135 Low-density lipoprotein receptor
IPR000033 1227 1271 SM00135 Low-density lipoprotein receptor
IPR000033 1272 1314 SM00135 Low-density lipoprotein receptor
IPR000033 1315 1355 SM00135 Low-density lipoprotein receptor
ProfileScan IPR003886 114 279 PS51220 Nidogen
IPR006605 534 764 PS50993 G2 nidogen and fibulin G2F
IPR000742 765 806 PS50026 EGF-like
IPR000742 807 849 PS50026 EGF-like
IPR000742 854 897 PS50026 EGF-like
IPR000742 898 934 PS50026 EGF-like
IPR000716 943 1011 PS51162 Thyroglobulin type-1
IPR000716 1022 1090 PS51162 Thyroglobulin type-1
IPR000033 1160 1203 PS51120 Low-density lipoprotein receptor
IPR000033 1204 1246 PS51120 Low-density lipoprotein receptor
IPR000033 1247 1291 PS51120 Low-density lipoprotein receptor
IPR000033 1292 1333 PS51120 Low-density lipoprotein receptor
ScanRegExp IPR000152 507 518 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 792 805 PS01186 EGF-like region
IPR001881 807 833 PS01187 EGF-like calcium-binding
IPR000152 824 835 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 833 848 PS01186 EGF-like region
IPR013032 883 896 PS01186 EGF-like region
IPR001881 898 922 PS01187 EGF-like calcium-binding
IPR000152 913 924 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 922 935 PS01186 EGF-like region
IPR000716 965 994 PS00484 Thyroglobulin type-1
IPR000716 1045 1074 PS00484 Thyroglobulin type-1
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp