ORK01848

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01848

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01848
Clone name	ah00691
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone ah00691 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCTC GGC) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	RASGRF1
cDNA sequence	DNA sequence (5393 bp) Predicted protein sequence (1294 aa)
HaloTag ORF Clone	FHC01848
Flexi ORF Clone	FXC01848
Description	Guanine nucleotide-releasing protein (GNRP) (Ras-specific nucleotide exchange factor CDC25) (Ras-specific guanine nucleotide-releasing factor).

Features of the cloned cDNA sequence

Description

Length: 5393 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1236 bp
Genome contig ID	gi51511731r_76940305
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ACCTCTTGCTAATAAATCTATTCTATCTCAGGGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAGCGAGTTTTGATGGGTTTCATTCGTTCAGTCAAGGAATATTTGATG

Features of the protein sequence

Description

Length: 1294 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11048	100.0	Ras protein-spe...	synthetic construct
XP_545892	93.6	similar to Ras ...	Canis lupus fam...
AAH40275	99.8	RASGRF1 protein...	Homo sapiens
XP_001153395	99.5	Ras protein-spe...	Pan troglodytes
XP_001488211	97.8	Ras protein-spe...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	60	166	PF00169	Pleckstrin-like
	IPR000048	240	260	PF00612	IQ calmodulin-binding region
	IPR000219	281	462	PF00621	DH
	IPR001849	494	621	PF00169	Pleckstrin-like
	IPR000651	671	1003	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	1056	1241	PF00617	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR001849	60	168	SM00233	Pleckstrin-like
	IPR000219	281	462	SM00325	DH
	IPR001849	494	623	SM00233	Pleckstrin-like
	IPR000651	667	803	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR000651	902	1029	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	1055	1292	SM00147	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR001849	59	166	PS50003	Pleckstrin-like
	IPR000048	241	266	PS50096	IQ calmodulin-binding region
	IPR000219	277	463	PS50010	DH
	IPR001849	504	621	PS50003	Pleckstrin-like
	IPR000651	668	783	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	1059	1291	PS50009	Guanine-nucleotide dissociation stimulator CDC25
ScanRegExp	IPR001331	411	436	PS00741	Guanine-nucleotide dissociation stimulator
ScanRegExp	IPR001895	1208	1238	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp