ORK01849

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01849

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01849
Clone name	hg01629
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MCF2
cDNA sequence	DNA sequence (6020 bp) Predicted protein sequence (907 aa)
HaloTag ORF Clone	FHC01849
Flexi ORF Clone	FXC01849
Description	Proto-oncogene DBL (Proto-oncogene MCF-2) [Contains: MCF2-transforming protein; DBL-transforming protein].

Features of the cloned cDNA sequence

Description

Length: 6020 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2974 bp
Genome contig ID	gi89161218r_138389322
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- CTGAACCATTTGACATTTATTAAAAATCTACACCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAACTGCAGAATGCATCATTATTTTCAAGTATACATGGAACATTCACC

Features of the protein sequence

Description

Length: 907 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11050	100.0	proto-oncogene ...	synthetic construct
CAI42107	95.8	MCF.2 cell line...	Homo sapiens
BAC41201	95.7	DBL proto-oncog...	Homo sapiens
XP_549296	83.0	similar to Prot...	Canis lupus fam...
CAM23838	71.0	mcf.2 transform...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	481	656	PF00621	DH
HMMPfam	IPR001849	687	791	PF00169	Pleckstrin-like
HMMSmart	IPR002017	187	288	SM00150	Spectrin repeat
	IPR000219	481	656	SM00325	DH
	IPR001849	687	793	SM00233	Pleckstrin-like
ProfileScan	IPR000219	477	657	PS50010	DH
ProfileScan	IPR001849	669	791	PS50003	Pleckstrin-like
ScanRegExp	IPR001331	606	631	PS00741	Guanine-nucleotide dissociation stimulator

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp