Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01855
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01855
Clone name ee09278
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF445
cDNA sequence DNA sequence (9086 bp)
Predicted protein sequence (1034 aa)
Flexi ORF Clone FXC01855
Description Zinc finger protein 445 (Zinc finger protein 168) (Zinc finger protein with KRAB and SCAN domains 15).
Features of the cloned cDNA sequence

Length: 9086 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 5645 bp
Genome contig ID gi89161205r_44358107
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGTGACAGAGCAAGACTCTGTCTC
Flanking genome sequence
(99321 - 99272)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAATGCCATGGCAACATCAGGAAGTAACACTATAT

Features of the protein sequence

Length: 1034 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P59923 0 100.0 Zinc finger pro...
Homo sapiens
EAW64708 0 99.9 zinc finger pro...
Homo sapiens
XP_001114939 0 97.9 similar to zinc...
Macaca mulatta
XP_001496663 0 79.4 similar to zinc...
Equus caballus
XP_848684 0 78.8 similar to zinc...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 488 511 PD000003 Zinc finger
IPR007087 516 539 PD000003 Zinc finger
IPR007087 602 623 PD000003 Zinc finger
IPR007087 686 707 PD000003 Zinc finger
IPR007087 765 788 PD000003 Zinc finger
IPR007087 793 816 PD000003 Zinc finger
IPR007087 845 866 PD000003 Zinc finger
IPR007087 981 1004 PD000003 Zinc finger
IPR007087 1009 1029 PD000003 Zinc finger
HMMPfam IPR003309 52 147 PF02023 Transcriptional regulator SCAN
IPR001909 237 277 PF01352 KRAB box
IPR007087 488 510 PF00096 Zinc finger
IPR007087 516 538 PF00096 Zinc finger
IPR007087 544 566 PF00096 Zinc finger
IPR007087 628 650 PF00096 Zinc finger
IPR007087 684 706 PF00096 Zinc finger
IPR007087 712 734 PF00096 Zinc finger
IPR007087 765 787 PF00096 Zinc finger
IPR007087 793 815 PF00096 Zinc finger
IPR007087 843 865 PF00096 Zinc finger
IPR007087 871 893 PF00096 Zinc finger
IPR007087 899 921 PF00096 Zinc finger
IPR007087 981 1003 PF00096 Zinc finger
IPR007087 1009 1031 PF00096 Zinc finger
HMMSmart IPR003309 54 166 SM00431 Transcriptional regulator SCAN
IPR001909 237 296 SM00349 KRAB box
IPR015880 488 510 SM00355 Zinc finger
IPR015880 516 538 SM00355 Zinc finger
IPR015880 544 566 SM00355 Zinc finger
IPR015880 600 622 SM00355 Zinc finger
IPR015880 628 650 SM00355 Zinc finger
IPR015880 684 706 SM00355 Zinc finger
IPR015880 712 734 SM00355 Zinc finger
IPR015880 765 787 SM00355 Zinc finger
IPR015880 793 815 SM00355 Zinc finger
IPR015880 843 865 SM00355 Zinc finger
IPR015880 871 893 SM00355 Zinc finger
IPR015880 899 921 SM00355 Zinc finger
IPR015880 981 1003 SM00355 Zinc finger
IPR015880 1009 1031 SM00355 Zinc finger
ProfileScan IPR003309 58 140 PS50804 Transcriptional regulator SCAN
IPR001909 237 307 PS50805 KRAB box
IPR007087 488 515 PS50157 Zinc finger
IPR007087 516 543 PS50157 Zinc finger
IPR007087 544 571 PS50157 Zinc finger
IPR007087 600 627 PS50157 Zinc finger
IPR007087 628 655 PS50157 Zinc finger
IPR007087 684 711 PS50157 Zinc finger
IPR007087 712 739 PS50157 Zinc finger
IPR007087 765 792 PS50157 Zinc finger
IPR007087 793 820 PS50157 Zinc finger
IPR007087 843 870 PS50157 Zinc finger
IPR007087 871 898 PS50157 Zinc finger
IPR007087 899 926 PS50157 Zinc finger
IPR007087 981 1008 PS50157 Zinc finger
IPR007087 1009 1034 PS50157 Zinc finger
ScanRegExp IPR007087 490 510 PS00028 Zinc finger
IPR007087 518 538 PS00028 Zinc finger
IPR007087 546 566 PS00028 Zinc finger
IPR007087 602 622 PS00028 Zinc finger
IPR007087 630 650 PS00028 Zinc finger
IPR007087 686 706 PS00028 Zinc finger
IPR007087 714 734 PS00028 Zinc finger
IPR007087 767 787 PS00028 Zinc finger
IPR007087 795 815 PS00028 Zinc finger
IPR007087 845 865 PS00028 Zinc finger
IPR007087 873 893 PS00028 Zinc finger
IPR007087 901 921 PS00028 Zinc finger
IPR007087 983 1003 PS00028 Zinc finger
IPR007087 1011 1031 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp