ORK01856

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01856

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01856
Clone name	hg04377
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RAPGEF1
cDNA sequence	DNA sequence (6603 bp) Predicted protein sequence (1294 aa)
HaloTag ORF Clone	FHC01856
Flexi ORF Clone	FXC01856
Description	Rap guanine nucleotide exchange factor 1 (Guanine nucleotide-releasing factor 2) (C3G protein) (CRK SH3-binding GNRP).

Features of the cloned cDNA sequence

Description

Length: 6603 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2716 bp
Genome contig ID	gi89161216r_133341989
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTATATGAAAAAAAATAAACACAGATGAAAGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCCCAATGCCATGTCCGCGCCCAGCTGCATGTGTGCAACTACAGTGACAG

Features of the protein sequence

Description

Length: 1294 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11058	0	100.0	Rap guanine nuc...	synthetic construct
BAE28079	0	88.7	unnamed protein...	Mus musculus
XP_001079347	0	86.9	similar to Rap ...	Rattus norvegicus
CAH18207	7.3e-203	86.5	hypothetical pr...	Homo sapiens
EAW87986	7.4e-203	85.6	Rap guanine nuc...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000651	908	1002	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
HMMPfam	IPR001895	1054	1231	PF00617	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR000651	904	1046	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
HMMSmart	IPR001895	1053	1282	SM00147	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR000651	905	1027	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
ProfileScan	IPR001895	1057	1281	PS50009	Guanine-nucleotide dissociation stimulator CDC25
ScanRegExp	IPR001895	1199	1228	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp