ORK01857

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01857

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01857
Clone name	pf11915
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FGD4
cDNA sequence	DNA sequence (8305 bp) Predicted protein sequence (848 aa)
HaloTag ORF Clone	FHC01857
Flexi ORF Clone	FXC01857
Description	FYVE, RhoGEF and PH domain-containing protein 4 (Actin filament- binding protein frabin) (FGD1-related F-actin-binding protein) (Zinc finger FYVE domain-containing protein 6).

Features of the cloned cDNA sequence

Description

Length: 8305 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5517 bp
Genome contig ID	gi89161190f_32446298
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CATTTGTATCTTGTAAATAAACACATCCTTAAATT
Flanking genome sequence (243953 - 244002)	----+--------+--------+--------+--------+----* AATTCCAAAGCTTTACATGTTATTTCAGCTCATGTTCAGTTCACAGTGAT

Features of the protein sequence

Description

Length: 848 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_520721	99.6	hypothetical pr...	Pan troglodytes
XP_001084734	97.9	similar to FYVE...	Macaca mulatta
Q96M96	100.0	FYVE, RhoGEF an...	Homo sapiens
BAB71413	99.8	unnamed protein...	Homo sapiens
XP_001136045	99.6	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	292	474	PF00621	DH
	IPR001849	505	603	PF00169	Pleckstrin-like
	IPR000306	636	702	PF01363	Zinc finger
	IPR001849	726	822	PF00169	Pleckstrin-like
HMMSmart	IPR000219	292	474	SM00325	DH
	IPR001849	505	605	SM00233	Pleckstrin-like
	IPR000306	633	702	SM00064	Zinc finger
	IPR001849	726	824	SM00233	Pleckstrin-like
ProfileScan	IPR000219	288	475	PS50010	DH
	IPR001849	504	603	PS50003	Pleckstrin-like
	IPR000306	641	701	PS50178	Zinc finger
	IPR001849	725	822	PS50003	Pleckstrin-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp