Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01860
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01860
Clone name ek00108
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CNOT4
cDNA sequence DNA sequence (3510 bp)
Predicted protein sequence (726 aa)
Flexi ORF Clone FXC01860
Description CCR4-NOT transcription complex subunit 4 (EC 6.3.2.-) (E3 ubiquitin protein ligase CNOT4) (CCR4-associated factor 4) (Potential transcriptional repressor NOT4Hp).
Features of the cloned cDNA sequence

Length: 3510 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1090 bp
Genome contig ID gi89161213r_134597088
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
AAAATCTTAAATAAAACAGAAAACTTGATGATGAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTGGGTTGTCCTTGTTTTTGTTTTTCTGTTTTGTTGGATGTGAGTTTG

Features of the protein sequence

Length: 726 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11069 0 100.0 CCR4-NOT transc...
synthetic construct
XP_001105643 0 99.4 CCR4-NOT transc...
Macaca mulatta
XP_859650 0 98.8 similar to CCR4...
Canis lupus fam...
XP_001145725 0 99.1 similar to Cnot...
Pan troglodytes
AAH58778 0 97.7 Cnot4 protein [...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 143 201 PF00076 RNA recognition motif
HMMSmart IPR003954 123 202 SM00361 RNA recognition
ProfileScan IPR001841 27 70 PS50089 Zinc finger
IPR000504 122 206 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp