Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01881
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01881
Clone name hj01819
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol COPA
cDNA sequence DNA sequence (4674 bp)
Predicted protein sequence (1225 aa)
Flexi ORF Clone FXC01881
Description Coatomer subunit alpha (Alpha-coat protein) (Alpha-COP) (HEPCOP) (HEP- COP) [Contains: Xenin (Xenopsin-related peptide); Proxenin].
Features of the cloned cDNA sequence

Length: 4674 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 882 bp
Genome contig ID gi89161185r_158425688
PolyA signal sequence
(AATAAA,-25)		 
+----*----+----*----+----*----+----
TCTCACACTAAATAAATCTCTATGAGAGCTTCTTG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACTTGGCCATTTATTTCTTGGACACTCTCATGTTCTTGTTCACCCATGCA

Features of the protein sequence

Length: 1225 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11074 0 100.0 coatomer subuni...
 synthetic construct
CAI15005 0 99.9 coatomer protei...
 Homo sapiens
P53621 0 99.8 Coatomer subuni...
 Homo sapiens
XP_001171498 0 99.7 coatomer protei...
 Pan troglodytes
XP_001928742 0 98.9 coatomer protei...
 Sus scrofa
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001680 48 81 PD000018 WD40 repeat
IPR001680 89 123 PD000018 WD40 repeat
IPR001680 131 165 PD000018 WD40 repeat
IPR001680 202 233 PD000018 WD40 repeat
IPR001680 245 278 PD000018 WD40 repeat
FPrintScan IPR001680 109 123 PR00320 WD40 repeat
IPR001680 151 165 PR00320 WD40 repeat
IPR001680 265 279 PR00320 WD40 repeat
HMMPfam IPR001680 1 38 PF00400 WD40 repeat
IPR001680 42 80 PF00400 WD40 repeat
IPR001680 84 122 PF00400 WD40 repeat
IPR001680 126 164 PF00400 WD40 repeat
IPR001680 196 234 PF00400 WD40 repeat
IPR001680 240 278 PF00400 WD40 repeat
IPR006692 339 783 PF04053 Coatomer
IPR010714 808 1225 PF06957 Coatomer
HMMSmart IPR001680 3 38 SM00320 WD40 repeat
IPR001680 41 80 SM00320 WD40 repeat
IPR001680 83 122 SM00320 WD40 repeat
IPR001680 125 164 SM00320 WD40 repeat
IPR001680 195 234 SM00320 WD40 repeat
IPR001680 239 278 SM00320 WD40 repeat
IPR001680 281 319 SM00320 WD40 repeat
ProfileScan IPR001680 6 40 PS50082 WD40 repeat
IPR001680 6 328 PS50294 WD40 repeat
IPR001680 48 89 PS50082 WD40 repeat
IPR001680 90 131 PS50082 WD40 repeat
IPR001680 132 166 PS50082 WD40 repeat
IPR001680 202 243 PS50082 WD40 repeat
IPR001680 246 287 PS50082 WD40 repeat
ScanRegExp IPR001680 151 165 PS00678 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp