Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01882
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01882
Clone name fk10876
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PIK3R2
cDNA sequence DNA sequence (3402 bp)
Predicted protein sequence (738 aa)
Flexi ORF Clone FXC01882
Description Phosphatidylinositol 3-kinase regulatory subunit beta (PI3-kinase p85- subunit beta) (PtdIns-3-kinase p85-beta).
Features of the cloned cDNA sequence

Length: 3402 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 780 bp
Genome contig ID gi42406306f_18027265
PolyA signal sequence
(AATACA,-26)		 
+----*----+----*----+----*----+----
ATCTACTAAAATACAAAAATTAGCCGGGCGTGGTG
Flanking genome sequence
(114621 - 114670)		 
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCCTGTAATCCCAGCTACTTGGGAGGCTGAGGCGTGAGAATCTC

Features of the protein sequence

Length: 738 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O00459 0 100.0 Phosphatidylino...
 Homo sapiens
EAW84659 0 99.8 phosphoinositid...
 Homo sapiens
AAD22671 0 99.7 P85B_HUMAN [Hom...
 Homo sapiens
XP_001114094 0 98.7 phosphoinositid...
 Macaca mulatta
XP_852406 0 96.3 similar to Phos...
 Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001452 19 86 PD000066 Src homology-3
IPR000980 340 437 PD000093 SH2 motif
IPR000980 632 711 PD000093 SH2 motif
FPrintScan IPR001720 334 352 PR00678 PI3 kinase
IPR001720 391 405 PR00678 PI3 kinase
IPR001720 430 453 PR00678 PI3 kinase
IPR001720 493 511 PR00678 PI3 kinase
IPR001720 512 534 PR00678 PI3 kinase
IPR001720 564 583 PR00678 PI3 kinase
IPR001720 584 609 PR00678 PI3 kinase
IPR000980 632 646 PR00401 SH2 motif
IPR001720 638 660 PR00678 PI3 kinase
IPR000980 651 661 PR00401 SH2 motif
IPR000980 662 673 PR00401 SH2 motif
IPR001720 663 680 PR00678 PI3 kinase
IPR001720 683 708 PR00678 PI3 kinase
IPR000980 695 709 PR00401 SH2 motif
HMMPfam IPR001452 17 88 PF00018 Src homology-3
IPR000198 135 274 PF00620 RhoGAP
IPR000980 340 415 PF00017 SH2 motif
IPR000980 632 706 PF00017 SH2 motif
HMMSmart IPR001452 17 89 SM00326 Src homology-3
IPR000198 132 302 SM00324 RhoGAP
IPR000980 338 421 SM00252 SH2 motif
IPR000980 630 712 SM00252 SH2 motif
ProfileScan IPR001452 14 90 PS50002 Src homology-3
IPR000198 119 305 PS50238 RhoGAP
IPR000980 340 435 PS50001 SH2 motif
IPR000980 632 726 PS50001 SH2 motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp