Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01886
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01886
Clone name ej01034
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TJP2
cDNA sequence DNA sequence (4500 bp)
Predicted protein sequence (1211 aa)
Flexi ORF Clone FXC01886
Description Tight junction protein ZO-2 (Zonula occludens 2 protein) (Zona occludens 2 protein) (Tight junction protein 2).
Features of the cloned cDNA sequence

Length: 4500 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 828 bp
Genome contig ID gi89161216f_70879010
PolyA signal sequence
(AATAAA,-27)		 
+----*----+----*----+----*----+----
TATAATTTAATAAAAAGGAATACATTGCAATCCGT
Flanking genome sequence
(180930 - 180979)		 
----+----*----+----*----+----*----+----*----+----*
AATTTTCTTTGTGGTGGATTTGTATGCTACTTCCTATTTTTAAATGCAAC

Features of the protein sequence

Length: 1211 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11079 0 100.0 tight junction ...
 synthetic construct
Q9UDY2 0 99.8 Tight junction ...
 Homo sapiens
AAH27592 0 99.7 Tight junction ...
 Homo sapiens
XP_520061 0 97.8 tight junction ...
 Pan troglodytes
AAC02527 0 99.8 tight junction ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR005419 51 63 PR01599 Zona occludens protein ZO-2
IPR005419 166 180 PR01599 Zona occludens protein ZO-2
IPR005417 392 414 PR01597 Zona occludens protein
IPR005419 438 459 PR01599 Zona occludens protein ZO-2
IPR005417 703 714 PR01597 Zona occludens protein
IPR005417 934 944 PR01597 Zona occludens protein
IPR005417 963 977 PR01597 Zona occludens protein
IPR005419 1046 1075 PR01599 Zona occludens protein ZO-2
IPR005419 1194 1208 PR01599 Zona occludens protein ZO-2
HMMPfam IPR001478 54 138 PF00595 PDZ/DHR/GLGF
IPR001478 330 403 PF00595 PDZ/DHR/GLGF
IPR001478 532 610 PF00595 PDZ/DHR/GLGF
IPR011511 629 688 PF07653 Variant SH3
IPR008144 799 856 PF00625 Guanylate kinase
HMMSmart IPR001478 63 141 SM00228 PDZ/DHR/GLGF
IPR001478 325 406 SM00228 PDZ/DHR/GLGF
IPR001478 540 613 SM00228 PDZ/DHR/GLGF
IPR008145 711 900 SM00072 Guanylate kinase/L-type calcium channel region
ProfileScan IPR001478 54 141 PS50106 PDZ/DHR/GLGF
IPR001478 328 406 PS50106 PDZ/DHR/GLGF
IPR001478 530 611 PS50106 PDZ/DHR/GLGF
IPR001452 625 690 PS50002 Src homology-3
IPR008144 711 897 PS50052 Guanylate kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp