Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01887
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01887
Clone name ph00327
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol HIP1
cDNA sequence DNA sequence (5637 bp)
Predicted protein sequence (1060 aa)
Flexi ORF Clone FXC01887
Description Huntingtin-interacting protein 1 (HIP-I).
Features of the cloned cDNA sequence

Length: 5637 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2445 bp
Genome contig ID gi89161213r_74903271
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCAGCCTGGGCAACAAGAGCAAAACTCCGTCTC
Flanking genome sequence
(99715 - 99666)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAATTACAAATGGGGCAAACAGTCTAGTGTAATGGATC

Features of the protein sequence

Length: 1060 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI10546 0 100.0 Huntingtin inte...
Homo sapiens
O00291 0 100.0 Huntingtin-inte...
Homo sapiens
AAL87037 0 99.9 huntingtin-inte...
Homo sapiens
XP_001109894 0 98.2 similar to hunt...
Macaca mulatta
AAC33564 0 99.8 huntingtin inte...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR002558 776 1051 PD011820 I/LWEQ
HMMPfam IPR011417 60 332 PF07651 ANTH
IPR002558 842 1035 PF01608 I/LWEQ
HMMSmart IPR013809 61 183 SM00273 Epsin-like
IPR002558 837 1035 SM00307 I/LWEQ
ProfileScan IPR013809 55 183 PS50942 Epsin-like
IPR002558 794 1035 PS50945 I/LWEQ
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp