ORK01888

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01888

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01888
Clone name	eh00644
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ITGA2
cDNA sequence	DNA sequence (5716 bp) Predicted protein sequence (1229 aa)
HaloTag ORF Clone	FHC01888
Flexi ORF Clone	FXC01888
Description	Integrin alpha-2 precursor (Platelet membrane glycoprotein Ia) (GPIa) (Collagen receptor) (VLA-2 alpha chain) (CD49b antigen).

Features of the cloned cDNA sequence

Description

Length: 5716 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2026 bp
Genome contig ID	gi51511721f_52220912
PolyA signal sequence (None)	+--------+--------+----*----+---- AGAATTTGCTGCTTCATTCCAACAAAATTTTATTT
Flanking genome sequence (203301 - 203350)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGACTGGAGAAACTAGTCATTAGCTTGATAAAGAA

Features of the protein sequence

Description

Length: 1229 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM34795	100.0	integrin, alpha...	Homo sapiens
P17301	99.9	Integrin alpha-...	Homo sapiens
XP_526928	99.6	hypothetical pr...	Pan troglodytes
EAW54873	99.8	integrin, alpha...	Homo sapiens
XP_001095246	97.9	integrin alpha ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002035	221	238	PR00453	von Willebrand factor
	IPR002035	258	272	PR00453	von Willebrand factor
	IPR002035	325	333	PR00453	von Willebrand factor
	IPR000413	482	494	PR01185	Integrins alpha chain
	IPR000413	499	510	PR01185	Integrins alpha chain
	IPR000413	532	552	PR01185	Integrins alpha chain
	IPR000413	601	625	PR01185	Integrins alpha chain
	IPR000413	666	687	PR01185	Integrins alpha chain
	IPR000413	797	810	PR01185	Integrins alpha chain
	IPR000413	1190	1209	PR01185	Integrins alpha chain
HMMPfam	IPR002035	222	409	PF00092	von Willebrand factor
	IPR013517	539	578	PF01839	FG-GAP
	IPR013517	602	637	PF01839	FG-GAP
	IPR013649	697	1108	PF08441	Integrin alpha-2
	IPR013513	1203	1217	PF00357	Integrin alpha chain
HMMSmart	IPR013519	92	147	SM00191	Integrin alpha beta-propellor
	IPR002035	220	410	SM00327	von Willebrand factor
	IPR013519	481	532	SM00191	Integrin alpha beta-propellor
	IPR013519	535	592	SM00191	Integrin alpha beta-propellor
	IPR013519	598	653	SM00191	Integrin alpha beta-propellor
	IPR013519	662	711	SM00191	Integrin alpha beta-propellor
ProfileScan	IPR002035	222	409	PS50234	von Willebrand factor
ScanRegExp	IPR013513	1202	1209	PS00242	Integrin alpha chain

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1181	GVIIGSIIAGILLLLALVAILWK	1203	PRIMARY	23