Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01890
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01890
Clone name pf02859
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol OPHN1
cDNA sequence DNA sequence (7584 bp)
Predicted protein sequence (805 aa)
Flexi ORF Clone FXC01890
Description Oligophrenin 1.
Features of the cloned cDNA sequence

Length: 7584 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4825 bp
Genome contig ID gi89161218r_67078915
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
ATGTGACTTTCAATAAAGTATGTAGACTGTCTAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATAAGTGGCCTCCATCTGCAGTTTTGTCATGGAAACAATCTTTGAGCATA

Features of the protein sequence

Length: 805 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O60890 0 100.0 Oligophrenin-1.
Homo sapiens
Q7YQL6 0 99.8 Oligophrenin-1.
Pan troglodytes
XP_001100242 0 99.6 oligophrenin 1 ...
Macaca mulatta
AAR90857 0 98.6 oligophrenin-1 ...
Cavia porcellus
XP_001504918 0 96.2 similar to olig...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001849 269 366 PF00169 Pleckstrin-like
IPR000198 391 545 PF00620 RhoGAP
HMMSmart IPR001849 269 373 SM00233 Pleckstrin-like
IPR000198 387 564 SM00324 RhoGAP
ProfileScan IPR001849 268 371 PS50003 Pleckstrin-like
IPR000198 383 567 PS50238 RhoGAP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp