ORK01891

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01891

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01891
Clone name	af02594
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARHGAP22
cDNA sequence	DNA sequence (2563 bp) Predicted protein sequence (667 aa)
HaloTag ORF Clone	FHC01891
Flexi ORF Clone	FXC01891
Description	Rho GTPase-activating protein 22 (Rho-type GTPase-activating protein 22).

Features of the cloned cDNA sequence

Description

Length: 2563 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	354 bp
Genome contig ID	gi89161187r_49224086
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CAGTCAGCTTTCTTTATTAAATGTGCTCACAAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGGTGCCTTGTTACCTGGCTCATTTTTCATGCCTCGCAATACAGGACAC

Features of the protein sequence

Description

Length: 667 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11084	0	100.0	Rho GTPase-acti...	synthetic construct
XP_001137640	0	97.8	Rho GTPase acti...	Pan troglodytes
XP_001108281	0	97.0	similar to Rho ...	Macaca mulatta
EAW93125	7.9e-192	99.2	Rho GTPase acti...	Homo sapiens
AAI26445	9.1e-192	91.7	ARHGAP22 protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	50	118	PF00169	Pleckstrin-like
HMMPfam	IPR000198	142	296	PF00620	RhoGAP
HMMSmart	IPR001849	50	133	SM00233	Pleckstrin-like
HMMSmart	IPR000198	139	315	SM00324	RhoGAP
ProfileScan	IPR001849	49	117	PS50003	Pleckstrin-like
ProfileScan	IPR000198	124	318	PS50238	RhoGAP

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp