Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01897
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01897
Clone name bm01840
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TWF2
cDNA sequence DNA sequence (1595 bp)
Predicted protein sequence (389 aa)
Flexi ORF Clone FXC01897
Description Twinfilin, actin-binding protein, homolog 2
Features of the cloned cDNA sequence

Length: 1595 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 423 bp
Genome contig ID gi89161205r_52137667
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GTATTTTCTAAAGAATAAAATATTTTTAAATCAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTGTGCTTGGCCCTGAGAGACCGCCTCTGGCCCTGGGAATTGGGCAGT

Features of the protein sequence

Length: 389 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q6IBS0 2.8e-140 100.0 Twinfilin-2; Tw...
Homo sapiens
CAG33013 4.3e-140 99.7 PTK9L [Homo sap...
Homo sapiens
AAY18888 8.2e-140 100.0 tyrosine kinase...
synthetic construct
XP_591897 2.2e-138 93.0 similar to A6 r...
Bos taurus
EDL77328 2.5e-136 96.8 protein tyrosin...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002108 51 179 PF00241 Actin-binding
IPR002108 224 353 PF00241 Actin-binding
HMMSmart IPR002108 51 179 SM00102 Actin-binding
IPR002108 224 353 SM00102 Actin-binding
ScanRegExp IPR002108 130 149 PS00325 Actin-binding
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp