ORK01902

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01902

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01902
Clone name	ef04216
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	GTF3C3
cDNA sequence	DNA sequence (2813 bp) Predicted protein sequence (876 aa)
HaloTag ORF Clone	FHC01902
Flexi ORF Clone	FXC01902
Description	General transcription factor 3C polypeptide 3 (Transcription factor IIIC-subunit gamma) (TF3C-gamma) (TFIIIC 102 kDa subunit) (TFIIIC102).

Features of the cloned cDNA sequence

Description

Length: 2813 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	182 bp
Genome contig ID	gi89161199r_197237350
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGATCTTGTGGTATATATGCAAAATTATTCCTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATTTGTATATTGGTCTGTCATTTTCCTTTCACATTCTATAGTGAAT

Features of the protein sequence

Description

Length: 876 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11095	0	100.0	general transcr...	synthetic construct
CAB70745	9.5e-156	95.9	hypothetical pr...	Homo sapiens
Q9Y5Q9	8.3e-155	96.7	General transcr...	Homo sapiens
XP_001087541	9.5e-155	95.7	general transcr...	Macaca mulatta
AAH43347	1.9e-154	96.6	General transcr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	202	235	PF00515	Tetratricopeptide TPR_1
	IPR013105	236	269	PF07719	Tetratricopeptide TPR_2
	IPR001440	801	834	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	168	201	SM00028	Tetratricopeptide region
	IPR013026	202	235	SM00028	Tetratricopeptide region
	IPR013026	236	269	SM00028	Tetratricopeptide region
	IPR013026	270	303	SM00028	Tetratricopeptide region
	IPR013026	801	834	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	168	342	PS50293	Tetratricopeptide region
	IPR013026	202	235	PS50005	Tetratricopeptide region
	IPR013026	236	269	PS50005	Tetratricopeptide region
	IPR013026	270	303	PS50005	Tetratricopeptide region
	IPR013026	447	479	PS50005	Tetratricopeptide region
	IPR013026	459	513	PS50293	Tetratricopeptide region
	IPR013026	801	834	PS50005	Tetratricopeptide region
	IPR013026	801	834	PS50293	Tetratricopeptide region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp