Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01903
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01903
Clone name ef06338
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol AGRN
cDNA sequence DNA sequence (7311 bp)
Predicted protein sequence (2059 aa)
Flexi ORF Clone FXC01903
Description Agrin precursor.
Features of the cloned cDNA sequence

Length: 7311 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1131 bp
Genome contig ID gi89161185f_845374
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GTGTCAATCGCTGTGAAATAAAGTCTGAAAACTTT
Flanking genome sequence
(135983 - 136032)
----+----*----+----*----+----*----+----*----+----*
AAAAGCATTGCTTTTGTCCATCCTCACCAGCGCGCTGGCCCGTTGGCTTC

Features of the protein sequence

Length: 2059 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O00468 0 100.0 Agrin; Flags: P...
Homo sapiens
AAC39776 0 99.9 agrin precursor...
Homo sapiens
XP_604151 0 84.7 similar to Agri...
Bos taurus
XP_536713 0 84.6 similar to agri...
Canis lupus fam...
EDL81364 0 82.1 agrin [Rattus n...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002049 560 578 PR00011 EGF-like
IPR002049 819 837 PR00011 EGF-like
IPR002049 873 891 PR00011 EGF-like
HMMPfam IPR004850 44 171 PF03146 Agrin NtA
IPR002350 211 256 PF00050 Proteinase inhibitor I1
IPR002350 286 331 PF00050 Proteinase inhibitor I1
IPR002350 356 403 PF00050 Proteinase inhibitor I1
IPR002350 430 475 PF00050 Proteinase inhibitor I1
IPR002350 504 548 PF00050 Proteinase inhibitor I1
IPR002350 569 613 PF00050 Proteinase inhibitor I1
IPR002350 634 678 PF00050 Proteinase inhibitor I1
IPR002350 719 764 PF00050 Proteinase inhibitor I1
IPR002049 807 858 PF00053 EGF-like
IPR002049 861 905 PF00053 EGF-like
IPR002350 937 983 PF00050 Proteinase inhibitor I1
IPR000082 1143 1254 PF01390 SEA
IPR006209 1347 1380 PF00008 EGF-like
IPR012679 1414 1545 PF00054 Laminin G
IPR006209 1567 1599 PF00008 EGF-like
IPR006209 1606 1638 PF00008 EGF-like
IPR012679 1682 1813 PF00054 Laminin G
IPR006209 1832 1866 PF00008 EGF-like
IPR012679 1911 2042 PF00054 Laminin G
HMMSmart IPR003645 185 210 SM00274 Follistatin-like
IPR003884 185 258 SM00057 Factor I membrane attack complex
IPR002350 210 256 SM00280 Proteinase inhibitor I1
IPR006210 261 300 SM00181 EGF
IPR003645 261 285 SM00274 Follistatin-like
IPR002350 285 331 SM00280 Proteinase inhibitor I1
IPR002350 360 403 SM00280 Proteinase inhibitor I1
IPR002350 429 475 SM00280 Proteinase inhibitor I1
IPR003645 481 503 SM00274 Follistatin-like
IPR002350 503 548 SM00280 Proteinase inhibitor I1
IPR003884 550 615 SM00057 Factor I membrane attack complex
IPR002350 568 613 SM00280 Proteinase inhibitor I1
IPR003645 615 638 SM00274 Follistatin-like
IPR003884 616 680 SM00057 Factor I membrane attack complex
IPR002350 626 678 SM00280 Proteinase inhibitor I1
IPR002350 718 764 SM00280 Proteinase inhibitor I1
IPR002049 807 858 SM00180 EGF-like
IPR002049 861 905 SM00180 EGF-like
IPR006210 872 906 SM00181 EGF
IPR006210 914 952 SM00181 EGF
IPR003645 914 936 SM00274 Follistatin-like
IPR003884 914 985 SM00057 Factor I membrane attack complex
IPR002350 936 983 SM00280 Proteinase inhibitor I1
IPR000082 1144 1266 SM00200 SEA
IPR006210 1346 1381 SM00181 EGF
IPR001881 1347 1381 SM00179 EGF-like calcium-binding
IPR001791 1406 1542 SM00282 Laminin G
IPR001881 1561 1600 SM00179 EGF-like calcium-binding
IPR006210 1566 1600 SM00181 EGF
IPR006210 1605 1639 SM00181 EGF
IPR001791 1674 1810 SM00282 Laminin G
IPR006210 1831 1867 SM00181 EGF
IPR001881 1832 1867 SM00179 EGF-like calcium-binding
IPR001791 1903 2039 SM00282 Laminin G
ProfileScan IPR004850 44 171 PS51121 Agrin NtA
IPR002049 807 860 PS50027 EGF-like
IPR002049 861 907 PS50027 EGF-like
IPR000082 1144 1266 PS50024 SEA
IPR000742 1343 1381 PS50026 EGF-like
IPR001791 1386 1562 PS50025 Laminin G
IPR000742 1563 1600 PS50026 EGF-like
IPR000742 1602 1639 PS50026 EGF-like
IPR001791 1649 1832 PS50025 Laminin G
IPR000742 1828 1867 PS50026 EGF-like
IPR001791 1878 2056 PS50025 Laminin G
ScanRegExp IPR013032 826 837 PS00022 EGF-like region
IPR002049 826 861 PS01248 EGF-like
IPR013032 880 891 PS00022 EGF-like region
IPR001455 1135 1159 PS01148 SirA-like
IPR013032 1369 1380 PS00022 EGF-like region
IPR013032 1588 1599 PS00022 EGF-like region
IPR013032 1627 1638 PS00022 EGF-like region
IPR013032 1855 1866 PS00022 EGF-like region
IPR013032 1855 1866 PS01186 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp