Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01904
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01904
Clone name eh00630
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ADAMTS18
cDNA sequence DNA sequence (5015 bp)
Predicted protein sequence (1264 aa)
Flexi ORF Clone FXC01904
Description ADAMTS-18 precursor (EC 3.4.24.-) (A disintegrin and metalloproteinase with thrombospondin motifs 18) (ADAM-TS 18) (ADAM-TS18).
Features of the cloned cDNA sequence

Length: 5015 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1031 bp
Genome contig ID gi51511732r_75774324
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
CGTTTAAATTTGCCCTAGGATTCAGCTAACAGCAG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGAGAGAAAGAAAGGAGTAAACAGTGGTAATA

Features of the protein sequence

Length: 1264 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11097 0 100.0 ADAM metallopep...
 synthetic construct
EAW95601 0 99.8 ADAM metallopep...
 Homo sapiens
Q8TE60 0 99.6 A disintegrin a...
 Homo sapiens
AAH63283 0 99.5 ADAM metallopep...
 Homo sapiens
XP_001143790 0 98.7 ADAM metallopep...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR013273 641 659 PR01857 Peptidase M12B
IPR013273 752 771 PR01857 Peptidase M12B
IPR013273 772 791 PR01857 Peptidase M12B
HMMPfam IPR002870 77 246 PF01562 Peptidase M12B
IPR001590 400 541 PF01421 Peptidase M12B
IPR000884 636 686 PF00090 Thrombospondin
IPR010294 792 904 PF05986 ADAM-TS Spacer 1
IPR000884 981 1034 PF00090 Thrombospondin
IPR000884 1041 1063 PF00090 Thrombospondin
IPR000884 1102 1122 PF00090 Thrombospondin
IPR000884 1174 1196 PF00090 Thrombospondin
IPR010909 1230 1262 PF08686 PLAC
HMMSmart IPR000884 635 687 SM00209 Thrombospondin
IPR000884 921 975 SM00209 Thrombospondin
IPR000884 977 1035 SM00209 Thrombospondin
IPR000884 1038 1092 SM00209 Thrombospondin
IPR000884 1098 1159 SM00209 Thrombospondin
IPR000884 1170 1216 SM00209 Thrombospondin
ProfileScan IPR001590 336 541 PS50215 Peptidase M12B
IPR000884 632 687 PS50092 Thrombospondin
IPR000884 974 1033 PS50092 Thrombospondin
IPR000884 1034 1092 PS50092 Thrombospondin
IPR000884 1095 1159 PS50092 Thrombospondin
IPR000884 1166 1221 PS50092 Thrombospondin
IPR010909 1227 1264 PS50900 PLAC
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp