Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01910
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01910
Clone name fj19808
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LIN7C
cDNA sequence DNA sequence (4826 bp)
Predicted protein sequence (199 aa)
Flexi ORF Clone FXC01910
Description Lin-7 homolog C (Lin-7C) (Mammalian lin-seven protein 3) (MALS-3) (Vertebrate lin-7 homolog 3) (Veli-3 protein).
Features of the cloned cDNA sequence

Length: 4826 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4225 bp
Genome contig ID gi51511727r_27372547
PolyA signal sequence
(CATAAA,-14)
+----*----+----*----+----*----+----
TCTATATTTTGCTTTGTCTTTCATAAAATTTAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACATTTTCTTGTGTTATTTCAAGAGCGGCAGTATGACGTGATTGAGA

Features of the protein sequence

Length: 199 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q5RAA5 1.5e-75 100.0 Protein lin-7 h...
Pongo abelii
XP_001502264 2.4e-75 99.4 similar to lin-...
Equus caballus
Q5F425 3.2e-75 100.0 Protein lin-7 h...
Gallus gallus
BAD96876 3.7e-75 99.4 lin-7 homolog C...
Homo sapiens
BAE22670 3.7e-75 99.4 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR014775 15 70 PF02828 L27
IPR001478 95 174 PF00595 PDZ/DHR/GLGF
HMMSmart IPR004172 15 70 SM00569 L27
IPR001478 103 177 SM00228 PDZ/DHR/GLGF
ProfileScan IPR004172 12 67 PS51022 L27
IPR001478 95 177 PS50106 PDZ/DHR/GLGF
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp