ORK01911

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01911

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01911
Clone name	fj21264
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LZTR1
cDNA sequence	DNA sequence (4326 bp) Predicted protein sequence (883 aa)
HaloTag ORF Clone	FHC01911
Flexi ORF Clone	FXC01911
Description	Leucine-zipper-like transcriptional regulator 1 (LZTR-1).

Features of the cloned cDNA sequence

Description

Length: 4326 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1674 bp
Genome contig ID	gi89161203f_19566543
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TATATGAATAAATGAAATTACATGCCAAGGGCCCT
Flanking genome sequence (116770 - 116819)	----+--------+--------+--------+--------+----* AAAAAGCAAATTTTACGAAATTGTGTGGCAGTTTCTGGGACTAGAATGAA

Features of the protein sequence

Description

Length: 883 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N653	100.0	Leucine-zipper-...	Homo sapiens
Q5R4Q7	99.0	Leucine-zipper-...	Pongo abelii
XP_583272	95.1	similar to Leuc...	Bos taurus
XP_849939	95.3	similar to Leuc...	Canis lupus fam...
Q9CQ33	95.1	Leucine-zipper-...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006652	110	150	PF01344	Kelch repeat type 1
	IPR011498	160	212	PF07646	Kelch repeat type 2
	IPR006652	217	246	PF01344	Kelch repeat type 1
	IPR006652	270	315	PF01344	Kelch repeat type 1
	IPR006652	326	371	PF01344	Kelch repeat type 1
	IPR006652	430	460	PF01344	Kelch repeat type 1
	IPR013069	698	807	PF00651	BTB/POZ
HMMSmart	IPR006652	122	171	SM00612	Kelch repeat type 1
	IPR006652	172	228	SM00612	Kelch repeat type 1
	IPR006652	282	337	SM00612	Kelch repeat type 1
	IPR006652	338	382	SM00612	Kelch repeat type 1
	IPR000210	486	617	SM00225	BTB/POZ-like
	IPR000210	710	811	SM00225	BTB/POZ-like
ProfileScan	IPR000210	486	580	PS50097	BTB/POZ-like
ProfileScan	IPR000210	710	779	PS50097	BTB/POZ-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp