ORK01916

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01916

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01916
Clone name	hj01700
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hj01700 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCGC CCACGCGTCC G) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	MPP5
cDNA sequence	DNA sequence (5172 bp) Predicted protein sequence (677 aa)
HaloTag ORF Clone	FHC01916
Flexi ORF Clone	FXC01916
Description	MAGUK p55 subfamily member 5.

Features of the cloned cDNA sequence

Description

Length: 5172 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2855 bp
Genome contig ID	gi51511730f_66677951
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- GTAAAAATAAAAAGTAAAATTATATTTCAAATTTT
Flanking genome sequence (194332 - 194381)	----+--------+--------+--------+--------+----* AAAAGCCACTAAGCAATTTCTCTTGCTATTTGCTCGGCCACTCAAGGTTT

Features of the protein sequence

Description

Length: 677 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N3R9	100.0	MAGUK p55 subfa...	Homo sapiens
AAH95485	99.8	Membrane protei...	Homo sapiens
BAF83929	99.7	unnamed protein...	Homo sapiens
Q5RDQ2	99.5	MAGUK p55 subfa...	Pongo abelii
CAD38620	99.5	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	350	410	PD000066	Src homology-3
FPrintScan	IPR001452	350	360	PR00452	Src homology-3
	IPR001452	371	386	PR00452	Src homology-3
	IPR001452	388	397	PR00452	Src homology-3
HMMPfam	IPR015145	125	173	PF09060	L27_N
	IPR014775	188	240	PF02828	L27
	IPR001478	258	335	PF00595	PDZ/DHR/GLGF
	IPR011511	351	417	PF07653	Variant SH3
	IPR008144	517	623	PF00625	Guanylate kinase
HMMSmart	IPR004172	125	182	SM00569	L27
	IPR004172	188	240	SM00569	L27
	IPR001478	267	338	SM00228	PDZ/DHR/GLGF
	IPR001452	350	418	SM00326	Src homology-3
	IPR008145	480	665	SM00072	Guanylate kinase/L-type calcium channel region
ProfileScan	IPR004172	122	179	PS51022	L27
	IPR004172	181	237	PS51022	L27
	IPR001478	258	338	PS50106	PDZ/DHR/GLGF
	IPR001452	347	419	PS50002	Src homology-3
	IPR008144	481	662	PS50052	Guanylate kinase
ScanRegExp	IPR008144	516	533	PS00856	Guanylate kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp