Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01917
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01917
Clone name hk02187
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MYBPC1
cDNA sequence DNA sequence (3749 bp)
Predicted protein sequence (1125 aa)
Flexi ORF Clone FXC01917
Description Myosin-binding protein C, slow-type (Slow MyBP-C) (C-protein, skeletal muscle slow isoform).
Features of the cloned cDNA sequence

Length: 3749 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 304 bp
Genome contig ID gi89161190f_100412898
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
GCCCAGATTGCTTAATTAAAAATTGCAAACAAAAT
Flanking genome sequence
(190879 - 190928)
----+----*----+----*----+----*----+----*----+----*
CTCATTTGAAGTCAGCACTTTGGTCATTATTATCTCTGCTCACTGTATTA

Features of the protein sequence

Length: 1125 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI17218 0 100.0 MYBPC1 protein ...
Homo sapiens
EAW97665 0 99.7 myosin binding ...
Homo sapiens
EAW97669 0 99.8 myosin binding ...
Homo sapiens
CAD91144 0 99.7 hypothetical pr...
Homo sapiens
CAD89907 0 99.7 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR003962 907 916 PR00014 Fibronectin
IPR003962 921 931 PR00014 Fibronectin
IPR003962 944 962 PR00014 Fibronectin
IPR003962 962 976 PR00014 Fibronectin
HMMPfam IPR013098 37 138 PF07679 Immunoglobulin I-set
IPR013098 231 316 PF07679 Immunoglobulin I-set
IPR013098 321 409 PF07679 Immunoglobulin I-set
IPR013098 412 497 PF07679 Immunoglobulin I-set
IPR013098 512 595 PF07679 Immunoglobulin I-set
IPR003961 599 685 PF00041 Fibronectin
IPR003961 697 783 PF00041 Fibronectin
IPR013098 800 889 PF07679 Immunoglobulin I-set
IPR003961 893 975 PF00041 Fibronectin
IPR013098 1008 1097 PF07679 Immunoglobulin I-set
HMMSmart IPR003599 43 139 SM00409 Immunoglobulin subtype
IPR003599 238 317 SM00409 Immunoglobulin subtype
IPR003599 327 408 SM00409 Immunoglobulin subtype
IPR003598 335 401 SM00408 Immunoglobulin subtype 2
IPR003599 418 498 SM00409 Immunoglobulin subtype
IPR003599 511 596 SM00409 Immunoglobulin subtype
IPR003598 517 585 SM00408 Immunoglobulin subtype 2
IPR003961 599 682 SM00060 Fibronectin
IPR003961 697 780 SM00060 Fibronectin
IPR003599 807 890 SM00409 Immunoglobulin subtype
IPR003598 813 879 SM00408 Immunoglobulin subtype 2
IPR003961 893 975 SM00060 Fibronectin
IPR003599 1014 1098 SM00409 Immunoglobulin subtype
IPR003598 1020 1087 SM00408 Immunoglobulin subtype 2
ProfileScan IPR007110 319 406 PS50835 Immunoglobulin-like
IPR007110 501 594 PS50835 Immunoglobulin-like
IPR003961 599 691 PS50853 Fibronectin
IPR003961 696 789 PS50853 Fibronectin
IPR007110 798 886 PS50835 Immunoglobulin-like
IPR003961 893 984 PS50853 Fibronectin
IPR007110 1008 1096 PS50835 Immunoglobulin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp