ORK01920

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01920

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01920
Clone name	sj00980
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RNF123
cDNA sequence	DNA sequence (4229 bp) Predicted protein sequence (1315 aa)
HaloTag ORF Clone	FHC01920
Flexi ORF Clone	FXC01920
Description	E3 ubiquitin-protein ligase RNF123 (EC 6.3.2.-) (RING finger protein 123) (Kip1 ubiquitination-promoting complex protein 1).

Features of the cloned cDNA sequence

Description

Length: 4229 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	223 bp
Genome contig ID	gi89161205f_49603566
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- AGGGCCACAGTGAGCATTAAATTATTATTCCATAC
Flanking genome sequence (130401 - 130450)	----+--------+--------+--------+--------+----* AGCCCTGGCCCTGGCCCTTCTTGAGGGAGTGGGGTTTGTGGGGTGTGCCC

Features of the protein sequence

Description

Length: 1315 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11113	100.0	E3 ubiquitin-pr...	synthetic construct
Q5XPI4	99.9	E3 ubiquitin-pr...	Homo sapiens
AAI30633	99.8	Ring finger pro...	Homo sapiens
BAG53271	99.7	unnamed protein...	Homo sapiens
CAL37940	99.4	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003877	133	254	PF00622	SPla/RYanodine receptor SPRY
HMMPfam	IPR001841	1255	1292	PF00097	Zinc finger
HMMSmart	IPR003877	133	254	SM00449	SPla/RYanodine receptor SPRY
HMMSmart	IPR001841	1255	1292	SM00184	Zinc finger
ProfileScan	IPR001870	75	255	PS50188	B302
ProfileScan	IPR001841	1255	1293	PS50089	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp