Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01935
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01935
Clone name fh00176s2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CDK19
cDNA sequence DNA sequence (6066 bp)
Predicted protein sequence (502 aa)
Flexi ORF Clone FXC01935
Description cell division cycle 2-like 6 (CDK8-like)
Features of the cloned cDNA sequence

Length: 6066 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4557 bp
Genome contig ID gi89161210r_110937874
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATATTCTTGGTTGAAATAAAATTTAATTGACTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTCTGTGTGGATTTTTTAAATATAAAAAAAATCTTATAATAAGGCTTAG

Features of the protein sequence

Length: 502 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9BWU1 6.9e-151 100.0 Cell division p...
Homo sapiens
BAF85049 1.8e-150 99.8 unnamed protein...
Homo sapiens
XP_589209 1.6e-147 98.2 similar to cell...
Bos taurus
Q8BWD8 5.6e-145 96.4 Cell division p...
Mus musculus
EDL87847 7e-145 96.4 cell division c...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 28 240 PD000001 Protein kinase
HMMPfam IPR000719 20 335 PF00069 Protein kinase
HMMSmart IPR001245 21 333 SM00219 Tyrosine protein kinase
IPR002290 21 335 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 21 335 PS50011 Protein kinase
ScanRegExp IPR000719 27 52 PS00107 Protein kinase
IPR008271 147 159 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp