ORK01996

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01996

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01996
Clone name	aj00696
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SASH1
cDNA sequence	DNA sequence (4811 bp) Predicted protein sequence (1353 aa)
HaloTag ORF Clone	FHC01996
Flexi ORF Clone	FXC01996
Description	SAM and SH3 domain-containing protein 1 (Proline-glutamate repeat- containing protein).

Features of the cloned cDNA sequence

Description

Length: 4811 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	507 bp
Genome contig ID	gi89161210f_148605337
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTGTTCAAAAGTTAGAACATCTGGCTGCACCAGG
Flanking genome sequence (306559 - 306608)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGTCCTGTTCTTCTTTAGATAAACAAGAGACATT

Features of the protein sequence

Description

Length: 1353 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_518791	98.8	SAM and SH3 dom...	Pan troglodytes
O94885	99.9	SAM and SH3 dom...	Homo sapiens
CAD47811	99.8	putative adapte...	Homo sapiens
AAH63279	99.7	SASH1 protein [...	Homo sapiens
EAW47816	99.9	SAM and SH3 dom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011511	664	719	PF07653	Variant SH3
	IPR011510	741	803	PF07647	Sterile alpha motif homology 2
	IPR011510	1280	1347	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001452	663	720	SM00326	Src homology-3
	IPR001660	736	803	SM00454	Sterile alpha motif SAM
	IPR001660	1280	1347	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	739	803	PS50105	Sterile alpha motif SAM
ProfileScan	IPR001660	1283	1347	PS50105	Sterile alpha motif SAM

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp