Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02018
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02018
Clone name sh02340
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CASKIN2
cDNA sequence DNA sequence (4958 bp)
Predicted protein sequence (1326 aa)
Flexi ORF Clone FXC02018
Description Caskin-2.
Features of the cloned cDNA sequence

Length: 4958 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 818 bp
Genome contig ID gi51511734r_70907938
PolyA signal sequence
(AATGAA,-22)
+----*----+----*----+----*----+----
CCCAACTAACACCAATGAAAACACCATTCCACGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTGGGCTGTGTGTTTGCCTCTGTGACATGGGGACCCCTGACCCTAGGGG

Features of the protein sequence

Length: 1326 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8WXE0 0 100.0 Caskin-2.
Homo sapiens
XP_001097098 0 98.1 similar to cask...
Macaca mulatta
BAG62095 0 99.9 unnamed protein...
Homo sapiens
XP_001495695 0 92.2 CASK interactin...
Equus caballus
XP_540433 0 91.8 similar to cask...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002110 239 251 PR01415 Ankyrin
IPR002110 357 369 PR01415 Ankyrin
HMMPfam IPR002110 172 204 PF00023 Ankyrin
IPR002110 205 237 PF00023 Ankyrin
IPR002110 238 270 PF00023 Ankyrin
IPR002110 271 293 PF00023 Ankyrin
IPR002110 312 344 PF00023 Ankyrin
IPR002110 347 376 PF00023 Ankyrin
IPR011511 409 469 PF07653 Variant SH3
IPR001660 611 674 PF00536 Sterile alpha motif SAM
IPR001660 680 744 PF00536 Sterile alpha motif SAM
HMMSmart IPR002110 172 201 SM00248 Ankyrin
IPR002110 205 234 SM00248 Ankyrin
IPR002110 238 267 SM00248 Ankyrin
IPR002110 271 300 SM00248 Ankyrin
IPR002110 312 341 SM00248 Ankyrin
IPR002110 344 373 SM00248 Ankyrin
IPR001452 408 470 SM00326 Src homology-3
IPR001660 610 676 SM00454 Sterile alpha motif SAM
IPR001660 679 746 SM00454 Sterile alpha motif SAM
ProfileScan IPR002110 165 382 PS50297 Ankyrin
IPR002110 172 204 PS50088 Ankyrin
IPR002110 205 237 PS50088 Ankyrin
IPR002110 238 270 PS50088 Ankyrin
IPR002110 312 344 PS50088 Ankyrin
IPR002110 344 376 PS50088 Ankyrin
IPR001452 405 471 PS50002 Src homology-3
IPR001660 613 676 PS50105 Sterile alpha motif SAM
IPR001660 682 746 PS50105 Sterile alpha motif SAM
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp