ORK02033

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02033

Order Kazusa clone(s) from :

Accession No	AB290162
Product ID	ORK02033
Clone name	fg03134y1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KIF17
cDNA sequence	DNA sequence (3776 bp) Predicted protein sequence (1068 aa)
HaloTag ORF Clone	FHC02033
Flexi ORF Clone	FXC02033
Description	Kinesin-like protein KIF17 (KIF3-related motor protein).

Features of the cloned cDNA sequence

Description

Length: 3776 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	568 bp
Genome contig ID	gi89161185r_20763096
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCACATTAAGCTGCCCAATAAACTGCTTTTAAGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCTCCCCTTCTCTGACCCTCTGACAGTGTCACTTGGGGCCCCTCCCTG

Features of the protein sequence

Description

Length: 1068 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_513170	98.5	kinesin family ...	Pan troglodytes
AAR33039	100.0	kinesin isoform...	Homo sapiens
Q9P2E2	99.9	Kinesin-like pr...	Homo sapiens
CAM12850	99.7	kinesin family ...	Homo sapiens
AAH65927	99.8	Kinesin family ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	121	142	PR00380	Kinesin
	IPR001752	240	257	PR00380	Kinesin
	IPR001752	274	292	PR00380	Kinesin
	IPR001752	324	345	PR00380	Kinesin
HMMPfam	IPR001752	50	375	PF00225	Kinesin
HMMSmart	IPR001752	42	382	SM00129	Kinesin
ProfileScan	IPR001752	41	304	PS50067	Kinesin
ScanRegExp	IPR001752	273	284	PS00411	Kinesin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp