Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02036
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02036
Clone name fj09783
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZFAT
cDNA sequence DNA sequence (4561 bp)
Predicted protein sequence (1276 aa)
Flexi ORF Clone FXC02036
Description Zinc finger protein 406 (ZFAT zinc finger 1).
Features of the cloned cDNA sequence

Length: 4561 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 692 bp
Genome contig ID gi51511724r_135459215
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
GGTGAGGTGGTTGGAATAAAAACAGTTCCTGTCTG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AATGCTTTGGTTCTTCAGGCGGGATGGCTTACATTTCCCCTTCCCAAGTT

Features of the protein sequence

Length: 1276 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9P243 0 99.9 Zinc finger pro...
 Homo sapiens
BAD12567 0 99.8 ZFAT-1 [Homo sa...
 Homo sapiens
BAD12568 0 99.8 ZFAT-2 [Homo sa...
 Homo sapiens
AAH25423 0 99.9 ZFAT protein [H...
 Homo sapiens
XP_519973 0 99.3 zinc finger pro...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 304 326 PF00096 Zinc finger
IPR007087 332 354 PF00096 Zinc finger
IPR007087 437 459 PF00096 Zinc finger
IPR007087 491 514 PF00096 Zinc finger
IPR007087 775 797 PF00096 Zinc finger
IPR007087 831 855 PF00096 Zinc finger
IPR007087 863 886 PF00096 Zinc finger
IPR007087 942 964 PF00096 Zinc finger
IPR007087 970 992 PF00096 Zinc finger
IPR007087 999 1021 PF00096 Zinc finger
IPR007087 1074 1097 PF00096 Zinc finger
HMMSmart IPR015880 45 68 SM00355 Zinc finger
IPR015880 149 169 SM00355 Zinc finger
IPR015880 304 326 SM00355 Zinc finger
IPR015880 332 354 SM00355 Zinc finger
IPR015880 359 382 SM00355 Zinc finger
IPR015880 387 410 SM00355 Zinc finger
IPR015880 437 459 SM00355 Zinc finger
IPR015880 465 487 SM00355 Zinc finger
IPR015880 491 514 SM00355 Zinc finger
IPR015880 775 797 SM00355 Zinc finger
IPR015880 803 826 SM00355 Zinc finger
IPR015880 831 855 SM00355 Zinc finger
IPR015880 863 886 SM00355 Zinc finger
IPR015880 913 936 SM00355 Zinc finger
IPR015880 942 964 SM00355 Zinc finger
IPR015880 970 992 SM00355 Zinc finger
IPR015880 999 1021 SM00355 Zinc finger
IPR015880 1027 1050 SM00355 Zinc finger
IPR015880 1074 1097 SM00355 Zinc finger
ProfileScan IPR007087 149 179 PS50157 Zinc finger
IPR007087 304 331 PS50157 Zinc finger
IPR007087 332 359 PS50157 Zinc finger
IPR007087 387 415 PS50157 Zinc finger
IPR007087 437 464 PS50157 Zinc finger
IPR007087 465 487 PS50157 Zinc finger
IPR007087 491 519 PS50157 Zinc finger
IPR007087 775 802 PS50157 Zinc finger
IPR007087 863 886 PS50157 Zinc finger
IPR007087 942 969 PS50157 Zinc finger
IPR007087 970 997 PS50157 Zinc finger
IPR007087 999 1026 PS50157 Zinc finger
IPR007087 1027 1055 PS50157 Zinc finger
ScanRegExp IPR007087 306 326 PS00028 Zinc finger
IPR007087 361 382 PS00028 Zinc finger
IPR007087 389 410 PS00028 Zinc finger
IPR007087 439 459 PS00028 Zinc finger
IPR007087 493 514 PS00028 Zinc finger
IPR007087 777 797 PS00028 Zinc finger
IPR007087 865 886 PS00028 Zinc finger
IPR005829 891 906 PS00216 Sugar transporter superfamily
IPR007087 972 992 PS00028 Zinc finger
IPR007087 1029 1050 PS00028 Zinc finger
IPR007087 1076 1097 PS00028 Zinc finger
IPR000886 1273 1276 PS00014 Endoplasmic reticulum targeting sequence
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp