ORK02071

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02071

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02071
Clone name	fk04190
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PPP1CB
cDNA sequence	DNA sequence (3610 bp) Predicted protein sequence (356 aa)
HaloTag ORF Clone	FHC02071
Flexi ORF Clone	FXC02071
Description	serine/threonine-protein phosphatase PP1-beta catalytic subunit

Features of the cloned cDNA sequence

Description

Length: 3610 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2363 bp
Genome contig ID	gi89161199f_28728232
PolyA signal sequence (None)	+--------+--------+----*----+---- ATAAAACTTTGTTTCTTAGGAGAAAATGATTCTGT
Flanking genome sequence (149802 - 149851)	----+--------+--------+--------+--------+----* AATTCCAGTGTCACTAATTTATATTGTTCTTTCCTCTGATTTTTTTCAGG

Features of the protein sequence

Description

Length: 356 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
1S70	6.8e-153	99.3
P61292	1.3e-152	100.0	Serine/threonin...	Sus scrofa
AAV38548	1.3e-152	100.0	protein phospha...	synthetic construct
AAX37132	1.3e-152	100.0	protein phospha...	synthetic construct
Q5I085	2.1e-152	99.6	Serine/threonin...	Xenopus (Silura...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR006186	112	143	PD000252	Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
FPrintScan	IPR006186	86	113	PR00114	Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
	IPR006186	115	142	PR00114	Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
	IPR006186	148	172	PR00114	Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
	IPR006186	182	208	PR00114	Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
	IPR006186	211	238	PR00114	Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
	IPR006186	268	288	PR00114	Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
	IPR006186	290	306	PR00114	Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
HMMPfam	IPR004843	85	280	PF00149	Metallophosphoesterase
HMMSmart	IPR006186	58	328	SM00156	Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
ScanRegExp	IPR006186	149	154	PS00125	Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp