Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02075
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02075
Clone name fk09382
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PFKM
cDNA sequence DNA sequence (2785 bp)
Predicted protein sequence (795 aa)
Flexi ORF Clone FXC02075
Description 6-phosphofructokinase, muscle type (EC 2.7.1.11) (Phosphofructokinase 1) (Phosphohexokinase) (Phosphofructo-1-kinase isozyme A) (PFK-A) (Phosphofructokinase-M).
Features of the cloned cDNA sequence

Length: 2785 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 396 bp
Genome contig ID gi89161190f_46702815
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GTAACTACACTAATAAATGCCAACTGGTCACTGTG
Flanking genome sequence
(123341 - 123390)
----+----*----+----*----+----*----+----*----+----*
CTTTTGCTTCTCCTGTTATCATCTTCCTAAGTGGAATGTAATACTGTCAG

Features of the protein sequence

Length: 795 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_509029 0 100.0 hypothetical pr...
Pan troglodytes
BAC86498 0 99.8 unnamed protein...
Homo sapiens
P08237 0 100.0 6-phosphofructo...
Homo sapiens
AAQ02441 0 100.0 phosphofructoki...
synthetic construct
CAH91137 0 99.7 hypothetical pr...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR015913 173 231 PD000707 Phosphofructokinase_core
IPR015913 535 594 PD000707 Phosphofructokinase_core
FPrintScan IPR000023 35 54 PR00476 Phosphofructokinase
IPR000023 60 73 PR00476 Phosphofructokinase
IPR000023 124 140 PR00476 Phosphofructokinase
IPR000023 174 191 PR00476 Phosphofructokinase
IPR000023 192 210 PR00476 Phosphofructokinase
IPR000023 212 228 PR00476 Phosphofructokinase
IPR000023 230 247 PR00476 Phosphofructokinase
IPR000023 269 281 PR00476 Phosphofructokinase
IPR000023 303 325 PR00476 Phosphofructokinase
HMMPfam IPR000023 31 341 PF00365 Phosphofructokinase
IPR000023 416 704 PF00365 Phosphofructokinase
HMMTigr IPR009161 31 772 TIGR02478 6-phosphofructokinase
ScanRegExp IPR015912 307 325 PS00433 Phosphofructokinase
IPR015912 670 688 PS00433 Phosphofructokinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp