Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02109
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209102
Product ID ORK02109
Clone name hh04944
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DTNA
cDNA sequence DNA sequence (6015 bp)
Predicted protein sequence (694 aa)
Flexi ORF Clone FXC02109
Description Dystrobrevin alpha (Dystrobrevin-alpha) (Dystrophin-related protein 3).
Features of the cloned cDNA sequence

Length: 6015 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3663 bp
Genome contig ID gi51511735f_30327327
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
GAATAATTTCTTCATTAAAAAATGTTTTTAAAACC
Flanking genome sequence
(398035 - 398084)
----+----*----+----*----+----*----+----*----+----*
ACTATATCTTGGGTGGTTTATTCCTTTGTTTCAGTGAATCTTTCCTAAAG

Features of the protein sequence

Length: 694 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92339 0 100.0 dystrobrevin al...
Homo sapiens
EAX01319 0 100.0 dystrobrevin, a...
Homo sapiens
NP_116757 0 99.5 dystrobrevin al...
Homo sapiens
ACE86506 0 98.6 dystrobrevin, a...
synthetic construct
ACE87187 0 98.6 dystrobrevin, a...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR015153 25 151 PF09068 EF-hand
IPR015154 155 243 PF09069 EF-hand
IPR000433 248 293 PF00569 Zinc finger
HMMSmart IPR000433 248 293 SM00291 Zinc finger
ProfileScan IPR000433 248 295 PS50135 Zinc finger
ScanRegExp IPR000433 254 281 PS01357 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp