Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02112
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02112
Clone name bm03209
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol GNAO1
cDNA sequence DNA sequence (2552 bp)
Predicted protein sequence (390 aa)
Flexi ORF Clone FXC02112
Description guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Features of the cloned cDNA sequence

Length: 2552 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1369 bp
Genome contig ID gi51511732f_54683531
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CCTGTGTAGCTCAATAAAAGAGAATGTTTGTCTGT
Flanking genome sequence
(265327 - 265376)
----+----*----+----*----+----*----+----*----+----*
ACTCCTGAGTCTCACCCTGTGCCTTCCAACGATGGTTATTTGGGGTGGGC

Features of the protein sequence

Length: 390 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EDL11106 3e-160 96.4 guanine nucleot...
Mus musculus
XP_510976 1.8e-152 100.0 guanine nucleot...
Pan troglodytes
XP_001096035 1.9e-152 100.0 similar to guan...
Macaca mulatta
P09471 8.9e-148 100.0 Guanine nucleot...
Homo sapiens
AAA52584 1.2e-146 99.1 guanine nucleot...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR011025 105 218 PD000281 G protein alpha subunit
FPrintScan IPR001019 71 86 PR00318 Guanine nucleotide binding protein (G-protein)
IPR001408 115 124 PR00441 G-protein alpha subunit
IPR001019 204 226 PR00318 Guanine nucleotide binding protein (G-protein)
IPR001408 222 232 PR00441 G-protein alpha subunit
IPR001019 233 250 PR00318 Guanine nucleotide binding protein (G-protein)
IPR001019 255 283 PR00318 Guanine nucleotide binding protein (G-protein)
IPR001019 301 310 PR00318 Guanine nucleotide binding protein (G-protein)
IPR001408 315 327 PR00441 G-protein alpha subunit
IPR001408 333 344 PR00441 G-protein alpha subunit
IPR001408 379 390 PR00441 G-protein alpha subunit
HMMPfam IPR001019 42 389 PF00503 Guanine nucleotide binding protein (G-protein)
HMMSmart NULL 49 389 SM00275 NULL
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp