ORK02117

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02117

Order Kazusa clone(s) from :

Accession No	AB209202
Product ID	ORK02117
Clone name	fj06329
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ETV1
cDNA sequence	DNA sequence (4390 bp) Predicted protein sequence (465 aa)
HaloTag ORF Clone	FHC02117
Flexi ORF Clone	FXC02117
Description	ETS translocation variant 1 (Protein ER81).

Features of the cloned cDNA sequence

Description

Length: 4390 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2836 bp
Genome contig ID	gi89161213r_13799180
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAAAGTGCTTCAGAATAAAAATCCACAAGACTGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGCAGAACATTTTTCTCAAATCATGGGCGGATCTTGGAGGTCTAGTTT

Features of the protein sequence

Description

Length: 465 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92439	1.8e-171	100.0	ets variant gen...	Homo sapiens
AAC62435	1.4e-167	99.7	ETS-related tra...	Homo sapiens
XP_518976	2.9e-167	99.5	ets variant gen...	Pan troglodytes
XP_862218	3.6e-166	98.6	similar to Ets ...	Canis lupus fam...
AAY58371	6.6e-98	65.6	ETS transcripti...	Danio rerio

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000418	323	336	PR00454	Ets
	IPR000418	347	365	PR00454	Ets
	IPR000418	366	384	PR00454	Ets
	IPR000418	385	403	PR00454	Ets
HMMPfam	IPR006715	12	321	PF04621	PEA3-type ETS-domain transcription factor
HMMPfam	IPR000418	322	405	PF00178	Ets
HMMSmart	IPR000418	322	407	SM00413	Ets
ProfileScan	IPR000418	323	403	PS50061	Ets
ScanRegExp	IPR000418	325	333	PS00345	Ets
ScanRegExp	IPR000418	369	384	PS00346	Ets

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp